Incidental Mutation 'R2655:Eif2b1'
ID252648
Institutional Source Beutler Lab
Gene Symbol Eif2b1
Ensembl Gene ENSMUSG00000029388
Gene Nameeukaryotic translation initiation factor 2B, subunit 1 (alpha)
SynonymsEIF2B, D5Ertd406e, 26kDa, EIF2BA
MMRRC Submission 040430-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R2655 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location124570213-124579131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124576854 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 120 (S120P)
Ref Sequence ENSEMBL: ENSMUSP00000118760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031333] [ENSMUST00000031334] [ENSMUST00000128920] [ENSMUST00000135163] [ENSMUST00000135361] [ENSMUST00000198318]
Predicted Effect probably benign
Transcript: ENSMUST00000031333
SMART Domains Protein: ENSMUSP00000031333
Gene: ENSMUSG00000029387

DomainStartEndE-ValueType
Pfam:Tfb4 8 287 2.1e-108 PFAM
low complexity region 299 306 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000031334
AA Change: S105P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031334
Gene: ENSMUSG00000029388
AA Change: S105P

DomainStartEndE-ValueType
Pfam:IF-2B 14 293 2.3e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126466
Predicted Effect probably damaging
Transcript: ENSMUST00000128920
AA Change: S120P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118760
Gene: ENSMUSG00000029388
AA Change: S120P

DomainStartEndE-ValueType
Pfam:IF-2B 28 133 1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135163
Predicted Effect possibly damaging
Transcript: ENSMUST00000135361
AA Change: S105P

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122923
Gene: ENSMUSG00000029388
AA Change: S105P

DomainStartEndE-ValueType
Pfam:IF-2B 13 172 2.4e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152716
Predicted Effect probably benign
Transcript: ENSMUST00000198318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200670
Meta Mutation Damage Score 0.282 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This gene encodes the alpha subunit of the eukaryotic translation initiation factor complex 2B (eIF2B). The eIF2B complex is a heterodecamer comprised of two molecules each of alpha, beta, gamma, delta and epsilon subunits. The eIF2B complex is a critical regulator of protein synthesis acting as the guanine nucleotide exchange factor for eIF2 to enable the formation of ternary complex that is required for the initiation of mRNA translation. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot5 T A 12: 84,075,876 S411R probably benign Het
Adamts12 A T 15: 11,065,088 N20Y possibly damaging Het
Bbs9 G A 9: 22,504,052 E91K probably damaging Het
Casp4 C A 9: 5,322,894 L57I possibly damaging Het
Cat T C 2: 103,471,846 K169E probably damaging Het
Cav1 A G 6: 17,339,360 Y148C probably damaging Het
Cep112 T C 11: 108,437,201 probably benign Het
Chaf1b T C 16: 93,891,511 S165P probably damaging Het
Crat A G 2: 30,402,691 S115P probably damaging Het
Epor A G 9: 21,960,720 S236P probably damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Igfbpl1 T C 4: 45,816,289 T179A probably damaging Het
Ighv14-4 T G 12: 114,176,448 Y114S probably damaging Het
Ipcef1 T C 10: 6,979,657 I29V probably benign Het
Junb A G 8: 84,977,508 S308P probably damaging Het
Kcnh5 T C 12: 75,114,540 E198G probably damaging Het
Ltbp1 G A 17: 75,005,983 R33H possibly damaging Het
Map3k20 C A 2: 72,433,420 T471K probably damaging Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr642 T C 7: 104,049,431 M308V probably benign Het
Olfr955 A T 9: 39,470,628 S33T probably benign Het
Patj T C 4: 98,437,450 V508A possibly damaging Het
Pkd1 T C 17: 24,576,490 V2319A probably damaging Het
Pnpla7 A G 2: 25,052,318 Y83C probably damaging Het
Prb1 G C 6: 132,210,462 Q19E unknown Het
Rasa3 T C 8: 13,595,373 T189A possibly damaging Het
Reck T A 4: 43,938,966 D777E probably benign Het
Rfx6 A G 10: 51,693,777 probably benign Het
Serpinb13 A G 1: 107,000,427 D259G probably damaging Het
Slit2 G A 5: 48,189,575 R253Q possibly damaging Het
Slu7 A G 11: 43,440,648 E203G probably benign Het
Syt4 A T 18: 31,443,544 D252E probably benign Het
Tpte A G 8: 22,311,278 probably null Het
Ttc25 T A 11: 100,553,579 W237R probably damaging Het
Ttll7 A G 3: 146,947,621 Y729C probably damaging Het
Usp35 T A 7: 97,312,147 T691S probably benign Het
Vmn1r211 A G 13: 22,852,416 V27A probably benign Het
Vmn2r72 T C 7: 85,751,269 T191A possibly damaging Het
Vwa5b1 C T 4: 138,594,303 G393D probably damaging Het
Other mutations in Eif2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Eif2b1 APN 5 124576869 missense probably damaging 1.00
IGL01541:Eif2b1 APN 5 124576902 missense probably damaging 1.00
IGL01757:Eif2b1 APN 5 124573140 missense probably benign 0.14
IGL03034:Eif2b1 APN 5 124571831 missense probably benign 0.01
R0066:Eif2b1 UTSW 5 124573795 unclassified probably null
R0094:Eif2b1 UTSW 5 124571766 missense probably benign 0.05
R4842:Eif2b1 UTSW 5 124576908 missense probably damaging 0.98
R5347:Eif2b1 UTSW 5 124578799 intron probably benign
R5620:Eif2b1 UTSW 5 124579012 start codon destroyed probably null 1.00
R5801:Eif2b1 UTSW 5 124574712 critical splice acceptor site probably null
R6481:Eif2b1 UTSW 5 124577111 missense probably benign 0.34
R6659:Eif2b1 UTSW 5 124579108 unclassified probably benign
R6850:Eif2b1 UTSW 5 124579006 missense probably benign 0.15
R7075:Eif2b1 UTSW 5 124571251 missense probably damaging 1.00
R7418:Eif2b1 UTSW 5 124576830 missense probably benign 0.11
X0066:Eif2b1 UTSW 5 124579057 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTACAGAGCGTCTCAGTCAC -3'
(R):5'- AATACTCTGTAAGCCCCGCC -3'

Sequencing Primer
(F):5'- GGGAGCTGCCGTCCTTATTAAC -3'
(R):5'- GTAAGCCCCGCCCTCCC -3'
Posted On2014-12-04