Incidental Mutation 'R2655:Rasa3'
ID252660
Institutional Source Beutler Lab
Gene Symbol Rasa3
Ensembl Gene ENSMUSG00000031453
Gene NameRAS p21 protein activator 3
SynonymsGAPIII, R-Ras gap, Ras GTPase-activating protein III, GAPIII activator 3, scat
MMRRC Submission 040430-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2655 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13566948-13677603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13595373 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 189 (T189A)
Ref Sequence ENSEMBL: ENSMUSP00000112998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117551] [ENSMUST00000154454]
Predicted Effect possibly damaging
Transcript: ENSMUST00000117551
AA Change: T189A

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112998
Gene: ENSMUSG00000031453
AA Change: T189A

DomainStartEndE-ValueType
C2 13 111 2.29e-15 SMART
C2 146 262 1.03e-17 SMART
RasGAP 275 614 3.96e-166 SMART
PH 577 679 5.53e-16 SMART
BTK 679 715 9.16e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132637
Predicted Effect probably benign
Transcript: ENSMUST00000154454
Meta Mutation Damage Score 0.356 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds inositol 1,3,4,5-tetrakisphosphate and stimulates the GTPase activity of Ras p21. This protein functions as a negative regulator of the Ras signalling pathway. It is localized to the cell membrane via a pleckstrin homology (PH) domain in the C-terminal region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation die at E12.5-13.5 of massive subcutaneous and intraparenchymal hemorrhage, probably due to underdeveloped adherens junctions between capillary endothelial cells. At E12.5, edema and severe hemorrhaging is frequently observed in the brain and/or rump. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot5 T A 12: 84,075,876 S411R probably benign Het
Adamts12 A T 15: 11,065,088 N20Y possibly damaging Het
Bbs9 G A 9: 22,504,052 E91K probably damaging Het
Casp4 C A 9: 5,322,894 L57I possibly damaging Het
Cat T C 2: 103,471,846 K169E probably damaging Het
Cav1 A G 6: 17,339,360 Y148C probably damaging Het
Cep112 T C 11: 108,437,201 probably benign Het
Chaf1b T C 16: 93,891,511 S165P probably damaging Het
Crat A G 2: 30,402,691 S115P probably damaging Het
Eif2b1 A G 5: 124,576,854 S120P probably damaging Het
Epor A G 9: 21,960,720 S236P probably damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Igfbpl1 T C 4: 45,816,289 T179A probably damaging Het
Ighv14-4 T G 12: 114,176,448 Y114S probably damaging Het
Ipcef1 T C 10: 6,979,657 I29V probably benign Het
Junb A G 8: 84,977,508 S308P probably damaging Het
Kcnh5 T C 12: 75,114,540 E198G probably damaging Het
Ltbp1 G A 17: 75,005,983 R33H possibly damaging Het
Map3k20 C A 2: 72,433,420 T471K probably damaging Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr642 T C 7: 104,049,431 M308V probably benign Het
Olfr955 A T 9: 39,470,628 S33T probably benign Het
Patj T C 4: 98,437,450 V508A possibly damaging Het
Pkd1 T C 17: 24,576,490 V2319A probably damaging Het
Pnpla7 A G 2: 25,052,318 Y83C probably damaging Het
Prb1 G C 6: 132,210,462 Q19E unknown Het
Reck T A 4: 43,938,966 D777E probably benign Het
Rfx6 A G 10: 51,693,777 probably benign Het
Serpinb13 A G 1: 107,000,427 D259G probably damaging Het
Slit2 G A 5: 48,189,575 R253Q possibly damaging Het
Slu7 A G 11: 43,440,648 E203G probably benign Het
Syt4 A T 18: 31,443,544 D252E probably benign Het
Tpte A G 8: 22,311,278 probably null Het
Ttc25 T A 11: 100,553,579 W237R probably damaging Het
Ttll7 A G 3: 146,947,621 Y729C probably damaging Het
Usp35 T A 7: 97,312,147 T691S probably benign Het
Vmn1r211 A G 13: 22,852,416 V27A probably benign Het
Vmn2r72 T C 7: 85,751,269 T191A possibly damaging Het
Vwa5b1 C T 4: 138,594,303 G393D probably damaging Het
Other mutations in Rasa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Rasa3 APN 8 13595410 unclassified probably benign
IGL02112:Rasa3 APN 8 13585042 splice site probably benign
IGL02946:Rasa3 APN 8 13598280 missense probably benign 0.33
IGL03085:Rasa3 APN 8 13585690 missense probably benign 0.11
Box_canyon UTSW 8 13584959 nonsense probably null
Mount_ouray UTSW 8 13631811 missense possibly damaging 0.90
Poncha_pass UTSW 8 13595373 missense possibly damaging 0.46
Ute UTSW 8 13582381 splice site probably benign
PIT4531001:Rasa3 UTSW 8 13605887 missense probably benign 0.11
R0193:Rasa3 UTSW 8 13570233 splice site probably null
R0710:Rasa3 UTSW 8 13583830 missense probably damaging 1.00
R0726:Rasa3 UTSW 8 13580118 splice site probably benign
R1405:Rasa3 UTSW 8 13588027 missense possibly damaging 0.83
R1405:Rasa3 UTSW 8 13588027 missense possibly damaging 0.83
R1797:Rasa3 UTSW 8 13582372 missense probably benign 0.44
R1828:Rasa3 UTSW 8 13585035 missense probably benign 0.02
R1895:Rasa3 UTSW 8 13631768 splice site probably benign
R2090:Rasa3 UTSW 8 13582381 splice site probably benign
R2374:Rasa3 UTSW 8 13577411 missense probably damaging 1.00
R3703:Rasa3 UTSW 8 13588972 missense probably benign
R3899:Rasa3 UTSW 8 13578635 missense probably benign 0.21
R4230:Rasa3 UTSW 8 13570264 missense possibly damaging 0.47
R4256:Rasa3 UTSW 8 13614532 critical splice donor site probably null
R4281:Rasa3 UTSW 8 13588946 missense probably benign 0.01
R4498:Rasa3 UTSW 8 13614587 missense probably benign 0.01
R4558:Rasa3 UTSW 8 13598259 missense probably damaging 0.96
R4559:Rasa3 UTSW 8 13598259 missense probably damaging 0.96
R4647:Rasa3 UTSW 8 13588865 missense probably null 0.00
R4702:Rasa3 UTSW 8 13570394 missense probably benign 0.09
R4772:Rasa3 UTSW 8 13598289 missense probably damaging 1.00
R4774:Rasa3 UTSW 8 13577501 missense probably benign 0.07
R4807:Rasa3 UTSW 8 13614633 missense probably damaging 1.00
R5008:Rasa3 UTSW 8 13584959 nonsense probably null
R5043:Rasa3 UTSW 8 13570368 missense possibly damaging 0.59
R5352:Rasa3 UTSW 8 13631778 missense possibly damaging 0.88
R5435:Rasa3 UTSW 8 13631811 missense possibly damaging 0.90
R6207:Rasa3 UTSW 8 13598251 missense possibly damaging 0.67
R6733:Rasa3 UTSW 8 13580037 missense possibly damaging 0.88
R6855:Rasa3 UTSW 8 13585029 missense probably damaging 1.00
R7024:Rasa3 UTSW 8 13631826 missense probably benign 0.29
R7100:Rasa3 UTSW 8 13586897 missense probably benign 0.02
R7322:Rasa3 UTSW 8 13595857 missense possibly damaging 0.46
R7394:Rasa3 UTSW 8 13595353 missense probably benign 0.03
R7478:Rasa3 UTSW 8 13614605 missense possibly damaging 0.70
R7486:Rasa3 UTSW 8 13590201 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGACACTTGGCTTTGGTCTC -3'
(R):5'- CCTGCTTTACATACCATCTGGG -3'

Sequencing Primer
(F):5'- TCTCCTGAGACTGAGGGAATCTC -3'
(R):5'- CTTTACATACCATCTGGGAGTGGAG -3'
Posted On2014-12-04