Incidental Mutation 'R2655:Epor'
ID252668
Institutional Source Beutler Lab
Gene Symbol Epor
Ensembl Gene ENSMUSG00000006235
Gene Nameerythropoietin receptor
Synonyms
MMRRC Submission 040430-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2655 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21958897-21963506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21960720 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 236 (S236P)
Ref Sequence ENSEMBL: ENSMUSP00000006397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006397] [ENSMUST00000053583] [ENSMUST00000213181]
Predicted Effect probably damaging
Transcript: ENSMUST00000006397
AA Change: S236P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006397
Gene: ENSMUSG00000006235
AA Change: S236P

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 37 139 9.1e-30 PFAM
FN3 144 227 2.48e-6 SMART
transmembrane domain 250 272 N/A INTRINSIC
low complexity region 434 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053583
SMART Domains Protein: ENSMUSP00000060331
Gene: ENSMUSG00000051238

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
low complexity region 40 52 N/A INTRINSIC
Blast:AAA 53 189 3e-34 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000213181
Meta Mutation Damage Score 0.304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the erythropoietin receptor which is a member of the cytokine receptor family. Upon erythropoietin binding, this receptor activates Jak2 tyrosine kinase which activates different intracellular pathways including: Ras/MAP kinase, phosphatidylinositol 3-kinase and STAT transcription factors. The stimulated erythropoietin receptor appears to have a role in erythroid cell survival. Defects in the erythropoietin receptor may produce erythroleukemia and familial erythrocytosis. Dysregulation of this gene may affect the growth of certain tumors. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this locus affect erythropoiesis. Targeted null mutants die at embryonic day 11-12.5 with severe anemia. Mutants with truncated alleles are viable with mild changes in erythropoiesis. A human mutation replacement allele produces polycythemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot5 T A 12: 84,075,876 S411R probably benign Het
Adamts12 A T 15: 11,065,088 N20Y possibly damaging Het
Bbs9 G A 9: 22,504,052 E91K probably damaging Het
Casp4 C A 9: 5,322,894 L57I possibly damaging Het
Cat T C 2: 103,471,846 K169E probably damaging Het
Cav1 A G 6: 17,339,360 Y148C probably damaging Het
Cep112 T C 11: 108,437,201 probably benign Het
Chaf1b T C 16: 93,891,511 S165P probably damaging Het
Crat A G 2: 30,402,691 S115P probably damaging Het
Eif2b1 A G 5: 124,576,854 S120P probably damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Igfbpl1 T C 4: 45,816,289 T179A probably damaging Het
Ighv14-4 T G 12: 114,176,448 Y114S probably damaging Het
Ipcef1 T C 10: 6,979,657 I29V probably benign Het
Junb A G 8: 84,977,508 S308P probably damaging Het
Kcnh5 T C 12: 75,114,540 E198G probably damaging Het
Ltbp1 G A 17: 75,005,983 R33H possibly damaging Het
Map3k20 C A 2: 72,433,420 T471K probably damaging Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr642 T C 7: 104,049,431 M308V probably benign Het
Olfr955 A T 9: 39,470,628 S33T probably benign Het
Patj T C 4: 98,437,450 V508A possibly damaging Het
Pkd1 T C 17: 24,576,490 V2319A probably damaging Het
Pnpla7 A G 2: 25,052,318 Y83C probably damaging Het
Prb1 G C 6: 132,210,462 Q19E unknown Het
Rasa3 T C 8: 13,595,373 T189A possibly damaging Het
Reck T A 4: 43,938,966 D777E probably benign Het
Rfx6 A G 10: 51,693,777 probably benign Het
Serpinb13 A G 1: 107,000,427 D259G probably damaging Het
Slit2 G A 5: 48,189,575 R253Q possibly damaging Het
Slu7 A G 11: 43,440,648 E203G probably benign Het
Syt4 A T 18: 31,443,544 D252E probably benign Het
Tpte A G 8: 22,311,278 probably null Het
Ttc25 T A 11: 100,553,579 W237R probably damaging Het
Ttll7 A G 3: 146,947,621 Y729C probably damaging Het
Usp35 T A 7: 97,312,147 T691S probably benign Het
Vmn1r211 A G 13: 22,852,416 V27A probably benign Het
Vmn2r72 T C 7: 85,751,269 T191A possibly damaging Het
Vwa5b1 C T 4: 138,594,303 G393D probably damaging Het
Other mutations in Epor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Epor APN 9 21960591 missense possibly damaging 0.50
IGL01377:Epor APN 9 21959297 missense probably damaging 1.00
IGL01400:Epor APN 9 21959439 unclassified probably null
IGL01462:Epor APN 9 21959456 missense probably damaging 1.00
R1741:Epor UTSW 9 21959771 missense probably damaging 1.00
R1983:Epor UTSW 9 21959400 missense probably benign 0.00
R2414:Epor UTSW 9 21959489 missense probably damaging 1.00
R2879:Epor UTSW 9 21959640 missense probably damaging 1.00
R4598:Epor UTSW 9 21961859 missense probably benign 0.00
R4599:Epor UTSW 9 21961859 missense probably benign 0.00
R5987:Epor UTSW 9 21962276 missense possibly damaging 0.83
R6462:Epor UTSW 9 21959255 missense probably benign 0.05
R7182:Epor UTSW 9 21963329 missense probably benign 0.01
R7413:Epor UTSW 9 21963480 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGGACGATCTAAGTCAGACCTC -3'
(R):5'- AATCCCTTTCTCACTGGGTG -3'

Sequencing Primer
(F):5'- CGATCTAAGTCAGACCTCAGGTG -3'
(R):5'- ATCCCTTTCTCACTGGGTGTGTTG -3'
Posted On2014-12-04