Incidental Mutation 'R2655:Kcnh5'
ID252686
Institutional Source Beutler Lab
Gene Symbol Kcnh5
Ensembl Gene ENSMUSG00000034402
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 5
Synonyms
MMRRC Submission 040430-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2655 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location74897220-75177332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75114540 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 198 (E198G)
Ref Sequence ENSEMBL: ENSMUSP00000046864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042299]
Predicted Effect probably damaging
Transcript: ENSMUST00000042299
AA Change: E198G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046864
Gene: ENSMUSG00000034402
AA Change: E198G

DomainStartEndE-ValueType
PAS 14 86 8.97e0 SMART
PAC 92 134 6.64e-7 SMART
Pfam:Ion_trans 214 479 1.2e-37 PFAM
Pfam:Ion_trans_2 390 473 5e-14 PFAM
cNMP 550 668 2.48e-15 SMART
low complexity region 710 717 N/A INTRINSIC
coiled coil region 907 944 N/A INTRINSIC
low complexity region 953 968 N/A INTRINSIC
Meta Mutation Damage Score 0.336 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of voltage-gated potassium channels. Members of this family have diverse functions, including regulating neurotransmitter and hormone release, cardiac function, and cell volume. This protein is an outward-rectifying, noninactivating channel. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted gene disruption display thigmotaxis and abnormal startle reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot5 T A 12: 84,075,876 S411R probably benign Het
Adamts12 A T 15: 11,065,088 N20Y possibly damaging Het
Bbs9 G A 9: 22,504,052 E91K probably damaging Het
Casp4 C A 9: 5,322,894 L57I possibly damaging Het
Cat T C 2: 103,471,846 K169E probably damaging Het
Cav1 A G 6: 17,339,360 Y148C probably damaging Het
Cep112 T C 11: 108,437,201 probably benign Het
Chaf1b T C 16: 93,891,511 S165P probably damaging Het
Crat A G 2: 30,402,691 S115P probably damaging Het
Eif2b1 A G 5: 124,576,854 S120P probably damaging Het
Epor A G 9: 21,960,720 S236P probably damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Igfbpl1 T C 4: 45,816,289 T179A probably damaging Het
Ighv14-4 T G 12: 114,176,448 Y114S probably damaging Het
Ipcef1 T C 10: 6,979,657 I29V probably benign Het
Junb A G 8: 84,977,508 S308P probably damaging Het
Ltbp1 G A 17: 75,005,983 R33H possibly damaging Het
Map3k20 C A 2: 72,433,420 T471K probably damaging Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr642 T C 7: 104,049,431 M308V probably benign Het
Olfr955 A T 9: 39,470,628 S33T probably benign Het
Patj T C 4: 98,437,450 V508A possibly damaging Het
Pkd1 T C 17: 24,576,490 V2319A probably damaging Het
Pnpla7 A G 2: 25,052,318 Y83C probably damaging Het
Prb1 G C 6: 132,210,462 Q19E unknown Het
Rasa3 T C 8: 13,595,373 T189A possibly damaging Het
Reck T A 4: 43,938,966 D777E probably benign Het
Rfx6 A G 10: 51,693,777 probably benign Het
Serpinb13 A G 1: 107,000,427 D259G probably damaging Het
Slit2 G A 5: 48,189,575 R253Q possibly damaging Het
Slu7 A G 11: 43,440,648 E203G probably benign Het
Syt4 A T 18: 31,443,544 D252E probably benign Het
Tpte A G 8: 22,311,278 probably null Het
Ttc25 T A 11: 100,553,579 W237R probably damaging Het
Ttll7 A G 3: 146,947,621 Y729C probably damaging Het
Usp35 T A 7: 97,312,147 T691S probably benign Het
Vmn1r211 A G 13: 22,852,416 V27A probably benign Het
Vmn2r72 T C 7: 85,751,269 T191A possibly damaging Het
Vwa5b1 C T 4: 138,594,303 G393D probably damaging Het
Other mutations in Kcnh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Kcnh5 APN 12 74897796 missense probably benign 0.00
IGL00675:Kcnh5 APN 12 75114189 critical splice donor site probably null
IGL00688:Kcnh5 APN 12 74898397 missense probably benign 0.01
IGL00721:Kcnh5 APN 12 75007676 missense probably benign 0.32
IGL00793:Kcnh5 APN 12 75114346 missense probably damaging 0.99
IGL00802:Kcnh5 APN 12 75007625 missense possibly damaging 0.62
IGL00920:Kcnh5 APN 12 74976493 missense probably damaging 1.00
IGL01595:Kcnh5 APN 12 74898327 missense probably benign 0.05
IGL01642:Kcnh5 APN 12 74965169 missense probably damaging 0.98
IGL01675:Kcnh5 APN 12 75114500 nonsense probably null
IGL01733:Kcnh5 APN 12 74965192 missense probably benign 0.02
IGL02006:Kcnh5 APN 12 74897548 missense probably damaging 0.99
IGL02075:Kcnh5 APN 12 75087605 missense probably benign 0.00
IGL02148:Kcnh5 APN 12 74897652 missense possibly damaging 0.86
IGL02155:Kcnh5 APN 12 75176538 utr 5 prime probably benign
IGL02304:Kcnh5 APN 12 74976697 missense probably benign 0.01
IGL02957:Kcnh5 APN 12 75007665 missense probably benign 0.01
R0305:Kcnh5 UTSW 12 75114397 missense probably benign 0.00
R0470:Kcnh5 UTSW 12 75114414 missense probably benign 0.22
R0553:Kcnh5 UTSW 12 75137673 missense probably benign 0.00
R0557:Kcnh5 UTSW 12 75114549 missense probably damaging 1.00
R0590:Kcnh5 UTSW 12 74965261 missense probably damaging 1.00
R0697:Kcnh5 UTSW 12 74976531 missense possibly damaging 0.80
R0699:Kcnh5 UTSW 12 74976531 missense possibly damaging 0.80
R1512:Kcnh5 UTSW 12 75119937 missense probably benign
R1728:Kcnh5 UTSW 12 75137691 missense probably benign 0.18
R1739:Kcnh5 UTSW 12 75114229 missense probably damaging 1.00
R1784:Kcnh5 UTSW 12 75137691 missense probably benign 0.18
R1956:Kcnh5 UTSW 12 74897584 missense probably benign 0.01
R1957:Kcnh5 UTSW 12 74897584 missense probably benign 0.01
R2155:Kcnh5 UTSW 12 74898456 critical splice acceptor site probably null
R2185:Kcnh5 UTSW 12 75130931 missense possibly damaging 0.95
R2237:Kcnh5 UTSW 12 75007719 missense probably benign 0.00
R2239:Kcnh5 UTSW 12 75007719 missense probably benign 0.00
R2483:Kcnh5 UTSW 12 75114471 missense probably damaging 1.00
R3767:Kcnh5 UTSW 12 75087576 missense possibly damaging 0.81
R3835:Kcnh5 UTSW 12 74898270 missense probably benign
R4681:Kcnh5 UTSW 12 75007623 missense probably benign 0.00
R4728:Kcnh5 UTSW 12 75007781 missense probably damaging 1.00
R4965:Kcnh5 UTSW 12 74965151 missense probably benign 0.11
R5127:Kcnh5 UTSW 12 74898084 missense probably benign 0.17
R5267:Kcnh5 UTSW 12 75087416 missense probably damaging 0.98
R5535:Kcnh5 UTSW 12 75130907 missense possibly damaging 0.76
R5590:Kcnh5 UTSW 12 74976689 missense probably benign 0.05
R5684:Kcnh5 UTSW 12 75137649 missense probably damaging 1.00
R5747:Kcnh5 UTSW 12 74898420 missense probably benign 0.04
R6123:Kcnh5 UTSW 12 75087591 missense probably benign 0.01
R6545:Kcnh5 UTSW 12 75007658 missense probably damaging 1.00
R6662:Kcnh5 UTSW 12 75007611 missense probably damaging 1.00
R7117:Kcnh5 UTSW 12 75114445 missense possibly damaging 0.87
R7161:Kcnh5 UTSW 12 74897709 missense probably benign 0.10
R7437:Kcnh5 UTSW 12 75137643 critical splice donor site probably null
Z1088:Kcnh5 UTSW 12 74897761 missense probably benign 0.00
Z1088:Kcnh5 UTSW 12 74965295 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGCTTCGGGTCAGAAATGAC -3'
(R):5'- CAAACTTTGGGGCAGTTCGG -3'

Sequencing Primer
(F):5'- GCCCCACAAAAGTCGTGTG -3'
(R):5'- CTTTGGGGCAGTTCGGAAAAG -3'
Posted On2014-12-04