Incidental Mutation 'R2655:Acot5'
ID252688
Institutional Source Beutler Lab
Gene Symbol Acot5
Ensembl Gene ENSMUSG00000042540
Gene Nameacyl-CoA thioesterase 5
SynonymsPTE-Ic
MMRRC Submission 040430-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2655 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84069325-84076020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84075876 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 411 (S411R)
Ref Sequence ENSEMBL: ENSMUSP00000042019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046422] [ENSMUST00000072505]
Predicted Effect probably benign
Transcript: ENSMUST00000046422
AA Change: S411R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000042019
Gene: ENSMUSG00000042540
AA Change: S411R

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 16 141 7.4e-44 PFAM
low complexity region 147 161 N/A INTRINSIC
Pfam:BAAT_C 203 412 3.5e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072505
SMART Domains Protein: ENSMUSP00000072322
Gene: ENSMUSG00000042540

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 15 142 1.6e-42 PFAM
low complexity region 147 161 N/A INTRINSIC
Pfam:BAAT_C 203 313 1.4e-29 PFAM
Meta Mutation Damage Score 0.1276 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,065,088 N20Y possibly damaging Het
Bbs9 G A 9: 22,504,052 E91K probably damaging Het
Casp4 C A 9: 5,322,894 L57I possibly damaging Het
Cat T C 2: 103,471,846 K169E probably damaging Het
Cav1 A G 6: 17,339,360 Y148C probably damaging Het
Cep112 T C 11: 108,437,201 probably benign Het
Chaf1b T C 16: 93,891,511 S165P probably damaging Het
Crat A G 2: 30,402,691 S115P probably damaging Het
Eif2b1 A G 5: 124,576,854 S120P probably damaging Het
Epor A G 9: 21,960,720 S236P probably damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Igfbpl1 T C 4: 45,816,289 T179A probably damaging Het
Ighv14-4 T G 12: 114,176,448 Y114S probably damaging Het
Ipcef1 T C 10: 6,979,657 I29V probably benign Het
Junb A G 8: 84,977,508 S308P probably damaging Het
Kcnh5 T C 12: 75,114,540 E198G probably damaging Het
Ltbp1 G A 17: 75,005,983 R33H possibly damaging Het
Map3k20 C A 2: 72,433,420 T471K probably damaging Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr642 T C 7: 104,049,431 M308V probably benign Het
Olfr955 A T 9: 39,470,628 S33T probably benign Het
Patj T C 4: 98,437,450 V508A possibly damaging Het
Pkd1 T C 17: 24,576,490 V2319A probably damaging Het
Pnpla7 A G 2: 25,052,318 Y83C probably damaging Het
Prb1 G C 6: 132,210,462 Q19E unknown Het
Rasa3 T C 8: 13,595,373 T189A possibly damaging Het
Reck T A 4: 43,938,966 D777E probably benign Het
Rfx6 A G 10: 51,693,777 probably benign Het
Serpinb13 A G 1: 107,000,427 D259G probably damaging Het
Slit2 G A 5: 48,189,575 R253Q possibly damaging Het
Slu7 A G 11: 43,440,648 E203G probably benign Het
Syt4 A T 18: 31,443,544 D252E probably benign Het
Tpte A G 8: 22,311,278 probably null Het
Ttc25 T A 11: 100,553,579 W237R probably damaging Het
Ttll7 A G 3: 146,947,621 Y729C probably damaging Het
Usp35 T A 7: 97,312,147 T691S probably benign Het
Vmn1r211 A G 13: 22,852,416 V27A probably benign Het
Vmn2r72 T C 7: 85,751,269 T191A possibly damaging Het
Vwa5b1 C T 4: 138,594,303 G393D probably damaging Het
Other mutations in Acot5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Acot5 APN 12 84075488 missense probably benign 0.01
IGL01978:Acot5 APN 12 84075398 missense possibly damaging 0.90
IGL03175:Acot5 APN 12 84075329 missense probably damaging 1.00
R0840:Acot5 UTSW 12 84075840 nonsense probably null
R1720:Acot5 UTSW 12 84075881 missense probably benign
R1735:Acot5 UTSW 12 84075487 missense probably benign 0.38
R2258:Acot5 UTSW 12 84075869 missense possibly damaging 0.94
R2260:Acot5 UTSW 12 84075869 missense possibly damaging 0.94
R2307:Acot5 UTSW 12 84075601 missense possibly damaging 0.90
R5291:Acot5 UTSW 12 84073519 missense probably benign 0.04
R5302:Acot5 UTSW 12 84073441 missense probably damaging 0.99
R5545:Acot5 UTSW 12 84069606 missense possibly damaging 0.69
R5999:Acot5 UTSW 12 84075554 missense probably benign 0.00
R6485:Acot5 UTSW 12 84075484 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTGTCTGCTACCCCAAAACAG -3'
(R):5'- TGCTAAGGCACAATGGGC -3'

Sequencing Primer
(F):5'- GGACACCACATTGAACCCC -3'
(R):5'- GGCTCAGTCCTTGGCATCATAAG -3'
Posted On2014-12-04