Incidental Mutation 'R2861:Xirp1'
ID252736
Institutional Source Beutler Lab
Gene Symbol Xirp1
Ensembl Gene ENSMUSG00000079243
Gene Namexin actin-binding repeat containing 1
SynonymsCmya1, Xin, mXin alpha
MMRRC Submission 040451-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R2861 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location120013755-120023598 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 120019815 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000107262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111635] [ENSMUST00000177637] [ENSMUST00000213113]
Predicted Effect probably null
Transcript: ENSMUST00000111635
AA Change: M1V

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107262
Gene: ENSMUSG00000079243
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
Pfam:Xin 89 104 1.7e-9 PFAM
Pfam:Xin 151 166 2.1e-9 PFAM
Pfam:Xin 186 201 1.6e-9 PFAM
Pfam:Xin 266 279 4.8e-9 PFAM
Pfam:Xin 303 317 1.1e-10 PFAM
Pfam:Xin 341 355 5.6e-8 PFAM
Pfam:Xin 376 391 6.7e-11 PFAM
Pfam:Xin 511 526 1.5e-12 PFAM
Pfam:Xin 549 563 2.6e-11 PFAM
Pfam:Xin 593 607 5.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213113
Meta Mutation Damage Score 0.356 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Homozygous mice exhibit cardiac hypertrophy and a disruption of cardiac intercalated disc structure and myofilament abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 36,965,849 S2079N probably damaging Het
Abca13 A G 11: 9,309,057 S2928G probably damaging Het
Abcc9 C T 6: 142,626,010 V1131M probably benign Het
Abcd1 T A X: 73,737,458 L713H probably damaging Het
Actg1 T C 11: 120,346,801 I52V probably benign Het
Ang G T 14: 51,101,818 D139Y probably damaging Het
Ano1 C T 7: 144,590,012 G1011E probably damaging Het
Apoe T C 7: 19,697,554 Y46C probably damaging Het
Ash1l T C 3: 89,054,478 W2386R probably damaging Het
Asph T C 4: 9,598,277 D250G probably damaging Het
Atr A G 9: 95,874,243 N836S probably benign Het
Btg3 A G 16: 78,364,980 V114A probably damaging Het
C2 T C 17: 34,863,878 T471A possibly damaging Het
C4b T A 17: 34,734,758 S959C probably damaging Het
Cap1 A T 4: 122,864,725 S221T probably benign Het
Capn2 A T 1: 182,472,920 probably benign Het
Cd38 A G 5: 43,901,433 S130G probably damaging Het
Cd8b1 A G 6: 71,334,101 R202G probably damaging Het
Col22a1 A G 15: 71,815,943 probably null Het
Cps1 A T 1: 67,166,375 E519V probably benign Het
Cyp2c38 G A 19: 39,460,694 R72W probably benign Het
Cyp3a16 A T 5: 145,455,499 Y215* probably null Het
F5 A T 1: 164,184,964 K482N probably damaging Het
Fam212a T C 9: 107,984,404 T238A probably benign Het
Fam45a T C 19: 60,814,794 S80P probably benign Het
Gab1 T C 8: 80,784,753 M488V probably benign Het
Gabpb1 A G 2: 126,653,574 I86T probably damaging Het
Gbx2 C T 1: 89,929,131 R179Q probably damaging Het
Gm11938 C A 11: 99,603,146 R41L probably damaging Het
Gpn1 A G 5: 31,497,320 D72G probably damaging Het
Greb1 A G 12: 16,711,745 S545P probably benign Het
Hsd3b7 T G 7: 127,802,270 L189R probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Il18r1 T C 1: 40,498,557 V494A possibly damaging Het
Itsn2 C A 12: 4,700,315 probably benign Het
Kcnn1 T C 8: 70,846,535 K487R probably benign Het
Kdf1 G A 4: 133,528,541 E190K probably damaging Het
Klhdc10 G A 6: 30,402,140 R48H unknown Het
Lama3 G T 18: 12,453,750 L723F probably damaging Het
Lama5 T C 2: 180,187,247 T2034A probably benign Het
Maged1 G A X: 94,538,924 P366S probably damaging Het
Med14 A G X: 12,719,697 I521T probably benign Het
Mia2 A G 12: 59,154,410 K841E probably damaging Het
Mrgbp G A 2: 180,583,410 R53Q possibly damaging Het
Mum1l1 G A X: 139,236,680 G656S possibly damaging Het
Nmnat2 G A 1: 153,112,425 V267I probably benign Het
Olfr1305 G T 2: 111,873,473 C127* probably null Het
Olfr231 A G 1: 174,117,732 Y95H probably damaging Het
Olfr490 A G 7: 108,286,962 S55P probably damaging Het
Olfr715b T A 7: 107,106,468 H131L probably benign Het
Opn4 A G 14: 34,593,828 probably null Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Parp16 G T 9: 65,233,804 D219Y probably damaging Het
Pitpnm2 G C 5: 124,121,437 H1224Q probably damaging Het
Pkd1 C T 17: 24,565,446 T322I probably benign Het
Pkhd1l1 A C 15: 44,540,871 T2299P probably damaging Het
Plin4 T C 17: 56,106,668 D319G probably damaging Het
Ppp6r3 A C 19: 3,521,782 S122R possibly damaging Het
Rims1 A T 1: 22,432,976 F653I probably benign Het
Rnf113a1 A G X: 37,192,083 E231G probably damaging Het
Rnf41 T C 10: 128,438,154 L225P possibly damaging Het
Ryr2 T C 13: 11,593,093 E876G probably damaging Het
Slc25a10 G A 11: 120,495,177 V115M probably damaging Het
Snx13 T A 12: 35,138,117 I798N probably benign Het
Sri A T 5: 8,067,540 Q178L probably benign Het
Tex14 T G 11: 87,474,417 D62E probably damaging Het
Tshz1 G T 18: 84,014,980 H434Q probably damaging Het
Vegfd A G X: 164,385,883 E57G probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r59 A G 7: 42,047,003 I105T possibly damaging Het
Vmn2r6 G T 3: 64,547,339 T513N probably benign Het
Vmn2r72 A T 7: 85,750,836 I335N probably damaging Het
Wiz G T 17: 32,361,706 T257K probably damaging Het
Other mutations in Xirp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Xirp1 APN 9 120017919 missense probably damaging 1.00
IGL02105:Xirp1 APN 9 120016997 missense probably damaging 1.00
IGL03365:Xirp1 APN 9 120018539 missense probably damaging 0.99
cornflower UTSW 9 120019815 start codon destroyed probably null 0.89
R0006:Xirp1 UTSW 9 120017454 missense probably benign 0.01
R0320:Xirp1 UTSW 9 120016467 missense probably benign 0.00
R0881:Xirp1 UTSW 9 120018417 missense possibly damaging 0.69
R1220:Xirp1 UTSW 9 120017916 missense possibly damaging 0.95
R1707:Xirp1 UTSW 9 120018775 missense possibly damaging 0.53
R1783:Xirp1 UTSW 9 120016907 missense probably benign
R1785:Xirp1 UTSW 9 120016907 missense probably benign
R1978:Xirp1 UTSW 9 120018591 missense probably benign 0.00
R1983:Xirp1 UTSW 9 120016629 nonsense probably null
R2064:Xirp1 UTSW 9 120016896 missense probably benign 0.00
R2860:Xirp1 UTSW 9 120018378 missense probably benign 0.04
R2860:Xirp1 UTSW 9 120019815 start codon destroyed probably null 0.89
R2861:Xirp1 UTSW 9 120018378 missense probably benign 0.04
R2919:Xirp1 UTSW 9 120018701 missense possibly damaging 0.81
R3013:Xirp1 UTSW 9 120019785 missense probably benign
R3704:Xirp1 UTSW 9 120016907 missense probably benign 0.04
R3898:Xirp1 UTSW 9 120019340 missense probably benign 0.00
R3981:Xirp1 UTSW 9 120017744 missense probably damaging 0.98
R4609:Xirp1 UTSW 9 120016506 missense probably benign
R4613:Xirp1 UTSW 9 120019682 missense probably damaging 1.00
R4660:Xirp1 UTSW 9 120016992 missense probably damaging 1.00
R4703:Xirp1 UTSW 9 120017027 missense probably damaging 1.00
R4825:Xirp1 UTSW 9 120017003 missense possibly damaging 0.77
R4993:Xirp1 UTSW 9 120018792 missense probably damaging 1.00
R5297:Xirp1 UTSW 9 120019602 missense probably damaging 1.00
R5939:Xirp1 UTSW 9 120018509 missense probably benign 0.01
R6091:Xirp1 UTSW 9 120017963 missense probably benign 0.01
R6290:Xirp1 UTSW 9 120018725 missense probably benign
R6376:Xirp1 UTSW 9 120018491 missense probably damaging 1.00
R6515:Xirp1 UTSW 9 120016917 missense probably benign 0.00
R6616:Xirp1 UTSW 9 120019014 missense probably damaging 0.98
R6976:Xirp1 UTSW 9 120017918 missense probably damaging 1.00
R7165:Xirp1 UTSW 9 120019047 missense probably damaging 1.00
V8831:Xirp1 UTSW 9 120016907 missense probably benign
X0025:Xirp1 UTSW 9 120019155 missense probably damaging 1.00
Z1088:Xirp1 UTSW 9 120016907 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTCGAGGTTCTTCCGAAG -3'
(R):5'- TAGGAAGCAGGGACTCATACTGATG -3'

Sequencing Primer
(F):5'- TCTTCCGAAGCTCAGGGTG -3'
(R):5'- GAATGGATGGACTATCATACTCCAGC -3'
Posted On2014-12-04