Incidental Mutation 'R0310:Kcnn2'
ID25277
Institutional Source Beutler Lab
Gene Symbol Kcnn2
Ensembl Gene ENSMUSG00000054477
Gene Namepotassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
Synonymsfri, SK2, small conductance calcium-activated potassium channel 2, bc
MMRRC Submission 038520-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R0310 (G1)
Quality Score224
Status Validated
Chromosome18
Chromosomal Location45268860-45686024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 45560518 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 387 (L387R)
Ref Sequence ENSEMBL: ENSMUSP00000067884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066890] [ENSMUST00000169783] [ENSMUST00000183850] [ENSMUST00000211323]
Predicted Effect probably damaging
Transcript: ENSMUST00000066890
AA Change: L387R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067884
Gene: ENSMUSG00000054477
AA Change: L387R

DomainStartEndE-ValueType
low complexity region 62 76 N/A INTRINSIC
low complexity region 84 90 N/A INTRINSIC
low complexity region 98 114 N/A INTRINSIC
low complexity region 129 141 N/A INTRINSIC
low complexity region 158 180 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 219 254 N/A INTRINSIC
low complexity region 279 289 N/A INTRINSIC
low complexity region 301 326 N/A INTRINSIC
low complexity region 345 373 N/A INTRINSIC
Pfam:SK_channel 380 493 2.2e-51 PFAM
transmembrane domain 516 535 N/A INTRINSIC
Pfam:Ion_trans_2 572 658 2.2e-14 PFAM
CaMBD 672 748 6.51e-51 SMART
coiled coil region 751 784 N/A INTRINSIC
low complexity region 815 839 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167895
SMART Domains Protein: ENSMUSP00000126285
Gene: ENSMUSG00000054477

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 36 61 N/A INTRINSIC
low complexity region 80 108 N/A INTRINSIC
Pfam:SK_channel 115 233 7e-61 PFAM
transmembrane domain 251 270 N/A INTRINSIC
Pfam:Ion_trans_2 306 394 6.2e-15 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000169783
AA Change: L122R
SMART Domains Protein: ENSMUSP00000129659
Gene: ENSMUSG00000054477
AA Change: L122R

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 36 61 N/A INTRINSIC
low complexity region 80 108 N/A INTRINSIC
Pfam:SK_channel 115 215 1.4e-36 PFAM
Pfam:Ion_trans_2 169 254 9.5e-15 PFAM
CaMBD 267 343 6.51e-51 SMART
coiled coil region 346 379 N/A INTRINSIC
low complexity region 410 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183850
AA Change: L122R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139350
Gene: ENSMUSG00000054477
AA Change: L122R

DomainStartEndE-ValueType
low complexity region 62 76 N/A INTRINSIC
low complexity region 84 90 N/A INTRINSIC
low complexity region 98 114 N/A INTRINSIC
low complexity region 129 141 N/A INTRINSIC
low complexity region 158 180 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 219 254 N/A INTRINSIC
low complexity region 279 289 N/A INTRINSIC
low complexity region 301 326 N/A INTRINSIC
low complexity region 345 373 N/A INTRINSIC
Pfam:SK_channel 380 498 2.9e-60 PFAM
transmembrane domain 516 535 N/A INTRINSIC
Pfam:Ion_trans_2 573 659 1.8e-14 PFAM
CaMBD 672 748 6.51e-51 SMART
coiled coil region 751 784 N/A INTRINSIC
low complexity region 815 839 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184101
Predicted Effect probably damaging
Transcript: ENSMUST00000211323
AA Change: L122R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.492 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 93.3%
  • 20x: 82.5%
Validation Efficiency 99% (113/114)
MGI Phenotype PHENOTYPE: Mice homozygous for a point mutation exhibit tremor and gait abnormalities. Homozygous null mice lack the apamin sensitive component of the medium afterhyperpolarization current but have normal hippocampal morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A C 9: 53,425,671 T92P probably damaging Het
9530053A07Rik G T 7: 28,142,274 V545L probably benign Het
Abca13 T C 11: 9,293,810 V1891A probably benign Het
Abcc1 T A 16: 14,410,927 I346N probably damaging Het
Afdn G T 17: 13,885,508 probably null Het
Ahrr G A 13: 74,283,024 probably benign Het
Akap13 A G 7: 75,614,930 D507G probably damaging Het
Akap8 A T 17: 32,316,260 M260K possibly damaging Het
Akr1b8 T C 6: 34,365,259 V265A probably benign Het
Alpk3 C G 7: 81,078,610 P496R possibly damaging Het
Ankrd13b A G 11: 77,472,745 V249A possibly damaging Het
Arid4a T C 12: 71,075,830 V995A probably benign Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atad2 G A 15: 58,114,257 A499V probably damaging Het
Barhl2 G T 5: 106,457,387 A152E possibly damaging Het
Bbs12 T A 3: 37,321,045 D547E probably damaging Het
Btaf1 A G 19: 37,004,534 M1655V probably damaging Het
Ccdc50 T A 16: 27,406,658 H40Q probably damaging Het
Ccr9 A T 9: 123,774,552 probably benign Het
Cdh15 A G 8: 122,865,436 D654G probably damaging Het
Cebpz T C 17: 78,926,124 D758G probably damaging Het
Cgn C T 3: 94,765,653 R906K possibly damaging Het
Chil3 T A 3: 106,160,523 M109L possibly damaging Het
Cntnap4 A T 8: 112,842,516 probably null Het
Cyp4f18 C T 8: 72,001,012 probably benign Het
Daam2 A G 17: 49,463,924 probably null Het
Ddost T A 4: 138,310,611 H220Q probably benign Het
Dennd2a C T 6: 39,464,201 probably benign Het
Depdc1b G A 13: 108,373,841 V296I possibly damaging Het
Dnah5 A T 15: 28,299,110 R1539S probably benign Het
Dusp22 T C 13: 30,705,658 I74T probably damaging Het
Dyx1c1 A T 9: 72,972,336 D386V probably damaging Het
E130309D02Rik G T 5: 143,307,888 T278K probably benign Het
Epc1 A G 18: 6,440,202 probably benign Het
Epha7 A G 4: 28,961,301 I845V probably benign Het
Fanci C T 7: 79,407,417 probably benign Het
Fbn1 T A 2: 125,363,644 E1104V probably damaging Het
Fbxo8 T A 8: 56,590,097 F205L probably damaging Het
Fetub T C 16: 22,929,756 probably benign Het
Frs3 T C 17: 47,703,822 V480A probably benign Het
Gne C A 4: 44,060,157 E79* probably null Het
Hrc T A 7: 45,336,497 H357Q probably benign Het
Idh1 T C 1: 65,161,920 M291V probably damaging Het
Iltifb T A 10: 118,293,185 H133L probably benign Het
Ino80b T C 6: 83,124,091 E165G probably damaging Het
Inppl1 A T 7: 101,828,499 probably benign Het
Ip6k2 T C 9: 108,799,233 probably benign Het
Itga11 A T 9: 62,760,346 I654F probably damaging Het
Jag2 G T 12: 112,913,377 probably benign Het
Katna1 G T 10: 7,743,749 probably benign Het
Kcnh4 G T 11: 100,746,169 S707Y probably benign Het
Khnyn A G 14: 55,887,968 T503A probably damaging Het
Lama5 G T 2: 180,181,566 probably benign Het
Lmbr1l A T 15: 98,908,773 probably benign Het
Mast4 A T 13: 102,754,161 S870T possibly damaging Het
Med1 A G 11: 98,167,574 Y266H probably benign Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mgam T C 6: 40,761,035 probably benign Het
Mmp8 A G 9: 7,561,454 Q153R probably benign Het
Mpeg1 C A 19: 12,461,691 T171N probably benign Het
Mtus2 T C 5: 148,107,019 S806P probably benign Het
Naip2 T A 13: 100,148,842 E1226V probably damaging Het
Naip6 A G 13: 100,308,213 F246L possibly damaging Het
Nav3 T C 10: 109,767,128 I1187V possibly damaging Het
Nbeal1 T C 1: 60,305,370 probably benign Het
Nbeal2 C A 9: 110,638,163 V653L probably damaging Het
Ndufa9 G T 6: 126,827,532 probably benign Het
Nlrp5 G T 7: 23,430,157 C883F probably damaging Het
Nr0b2 C A 4: 133,555,992 probably null Het
Olfr24 T A 9: 18,755,333 M101L possibly damaging Het
Olfr799 T A 10: 129,647,731 V201E probably damaging Het
Olfr822 G A 10: 130,074,823 V138I probably benign Het
Olfr888 T A 9: 38,109,486 S267T possibly damaging Het
Pkhd1 A T 1: 20,549,822 probably null Het
Pkhd1l1 A G 15: 44,522,738 probably benign Het
Ppm1l A G 3: 69,549,461 K237R probably benign Het
Ppp1r18 T C 17: 35,873,711 probably benign Het
Ptpn3 A T 4: 57,204,958 D734E probably benign Het
Pxdn T C 12: 30,015,529 C1283R probably damaging Het
Rbm12 A G 2: 156,095,724 probably benign Het
Rttn A T 18: 89,009,460 probably benign Het
Sgsm1 G T 5: 113,263,705 H431Q probably benign Het
Siah3 A G 14: 75,525,927 N206S possibly damaging Het
Slc22a15 G T 3: 101,860,511 D521E probably benign Het
Sprr2k A T 3: 92,433,463 probably benign Het
Stab2 G A 10: 86,967,613 probably benign Het
Sval3 T A 6: 41,968,186 L16Q probably damaging Het
Sycp2 C G 2: 178,381,855 S456T probably benign Het
Tk1 T C 11: 117,817,095 probably benign Het
Tlk2 C A 11: 105,254,973 A335E probably benign Het
Tmtc1 T C 6: 148,249,581 K659E probably benign Het
Tnk2 C T 16: 32,680,590 P907L probably benign Het
Trim14 C A 4: 46,522,043 K211N probably damaging Het
Trim15 A C 17: 36,866,986 L39R probably damaging Het
Tspan15 T A 10: 62,188,093 T269S probably benign Het
Ttc7 T A 17: 87,361,864 D646E probably benign Het
Ttll6 A T 11: 96,147,556 Q410L probably benign Het
Unc79 A G 12: 103,061,407 Q419R probably damaging Het
Vcam1 A T 3: 116,114,416 Y666N possibly damaging Het
Vmn1r10 A T 6: 57,113,501 Y26F probably damaging Het
Vmn1r80 A G 7: 12,193,848 N295S probably benign Het
Vmn2r114 A T 17: 23,290,943 H854Q probably benign Het
Vmn2r2 A T 3: 64,134,618 D225E probably damaging Het
Vmn2r4 A T 3: 64,389,434 Y643* probably null Het
Vmn2r52 T A 7: 10,159,466 Y582F probably damaging Het
Vmn2r60 G T 7: 42,195,140 L642F possibly damaging Het
Zbtb20 T C 16: 43,609,746 S207P probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Zkscan7 G T 9: 122,888,893 E118* probably null Het
Other mutations in Kcnn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Kcnn2 APN 18 45592236 missense probably damaging 0.98
IGL00341:Kcnn2 APN 18 45677071 splice site probably benign
IGL01317:Kcnn2 APN 18 45560627 splice site probably null
IGL02121:Kcnn2 APN 18 45561273 missense probably damaging 0.98
IGL02561:Kcnn2 APN 18 45592192 missense possibly damaging 0.59
IGL03000:Kcnn2 APN 18 45560568 missense probably damaging 0.97
IGL03116:Kcnn2 APN 18 45655206 missense probably damaging 1.00
IGL03155:Kcnn2 APN 18 45685315 missense probably damaging 0.99
IGL03289:Kcnn2 APN 18 45677044 missense probably damaging 1.00
IGL03343:Kcnn2 APN 18 45676959 missense probably damaging 0.97
jitter UTSW 18 45561253 synonymous silent
I2288:Kcnn2 UTSW 18 45675273 intron probably benign
R0256:Kcnn2 UTSW 18 45592405 missense probably damaging 0.98
R0464:Kcnn2 UTSW 18 45560359 missense probably damaging 0.99
R0468:Kcnn2 UTSW 18 45559471 missense possibly damaging 0.96
R0485:Kcnn2 UTSW 18 45560148 missense probably benign 0.06
R0722:Kcnn2 UTSW 18 45559476 missense possibly damaging 0.73
R0898:Kcnn2 UTSW 18 45559476 missense possibly damaging 0.73
R1567:Kcnn2 UTSW 18 45670334 splice site probably null
R4543:Kcnn2 UTSW 18 45559648 missense probably benign 0.00
R4720:Kcnn2 UTSW 18 45683120 missense possibly damaging 0.78
R4732:Kcnn2 UTSW 18 45560349 missense possibly damaging 0.94
R4733:Kcnn2 UTSW 18 45560349 missense possibly damaging 0.94
R4801:Kcnn2 UTSW 18 45685267 splice site probably benign
R4844:Kcnn2 UTSW 18 45683120 missense possibly damaging 0.78
R4927:Kcnn2 UTSW 18 45559731 missense probably benign 0.01
R5011:Kcnn2 UTSW 18 45685285 missense possibly damaging 0.86
R5108:Kcnn2 UTSW 18 45592055 missense probably damaging 0.99
R5805:Kcnn2 UTSW 18 45683131 missense probably damaging 0.98
R5841:Kcnn2 UTSW 18 45559396 missense probably benign
R5888:Kcnn2 UTSW 18 45592345 missense probably damaging 0.98
R5926:Kcnn2 UTSW 18 45685284 missense probably benign 0.01
R6552:Kcnn2 UTSW 18 45560098 missense probably benign 0.00
R6882:Kcnn2 UTSW 18 45559438 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ATTCTAACAACCTGGCGCTCTACG -3'
(R):5'- GAGAACTTAACTCTCCGAGTTGCCC -3'

Sequencing Primer
(F):5'- CTCTACGGGACTggcgg -3'
(R):5'- CCGGGACACTTAAGACCTGTTAG -3'
Posted On2013-04-16