Incidental Mutation 'R2862:Il18r1'
ID252881
Institutional Source Beutler Lab
Gene Symbol Il18r1
Ensembl Gene ENSMUSG00000026070
Gene Nameinterleukin 18 receptor 1
SynonymsIl18ralpha, Il1rrp
MMRRC Submission 040452-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2862 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location40465552-40500854 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40498557 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 494 (V494A)
Ref Sequence ENSEMBL: ENSMUSP00000142070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087983] [ENSMUST00000108044] [ENSMUST00000195684]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087983
AA Change: V494A

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000085298
Gene: ENSMUSG00000026070
AA Change: V494A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108044
AA Change: V494A

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103679
Gene: ENSMUSG00000026070
AA Change: V494A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000195684
AA Change: V494A

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142070
Gene: ENSMUSG00000026070
AA Change: V494A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This receptor specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. This gene along with four other members of the interleukin 1 receptor family, including IL1R2, IL1R1, ILRL2 (IL-1Rrp2), and IL1RL1 (T1/ST2), form a gene cluster on chromosome 2q. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit impaire Th1 cell development and defective NK cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,485,911 probably benign Het
Abca13 A G 11: 9,309,057 S2928G probably damaging Het
Abcd1 T A X: 73,737,458 L713H probably damaging Het
Actg1 T C 11: 120,346,801 I52V probably benign Het
Ahi1 T A 10: 20,981,408 V634E probably damaging Het
Ang G T 14: 51,101,818 D139Y probably damaging Het
Apoe T C 7: 19,697,554 Y46C probably damaging Het
Aqr A T 2: 114,136,917 V539D probably damaging Het
Btg3 A G 16: 78,364,980 V114A probably damaging Het
Cap1 A T 4: 122,864,725 S221T probably benign Het
Cdca2 T C 14: 67,698,090 E392G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col22a1 A G 15: 71,815,943 probably null Het
Cyp2c38 G A 19: 39,460,694 R72W probably benign Het
Dnah1 C T 14: 31,284,762 G2199S probably benign Het
Dnhd1 A G 7: 105,712,559 E3608G probably benign Het
Ears2 A T 7: 122,062,940 L95Q probably damaging Het
F5 A T 1: 164,184,964 K482N probably damaging Het
Gata5 C T 2: 180,334,336 G12S possibly damaging Het
Gm11938 C A 11: 99,603,146 R41L probably damaging Het
Grap2 A T 15: 80,647,964 Q260L probably damaging Het
Greb1 A G 12: 16,711,745 S545P probably benign Het
Iglc1 T C 16: 19,061,910 probably benign Het
Kdf1 G A 4: 133,528,541 E190K probably damaging Het
Lama2 G A 10: 27,422,612 Q163* probably null Het
Lama3 G T 18: 12,453,750 L723F probably damaging Het
Lamp5 A T 2: 136,058,946 H22L probably benign Het
Maged1 G A X: 94,538,924 P366S probably damaging Het
Med14 A G X: 12,719,697 I521T probably benign Het
Mia2 A G 12: 59,154,410 K841E probably damaging Het
Mrgbp G A 2: 180,583,410 R53Q possibly damaging Het
Mrps18b G A 17: 35,910,854 S101L probably benign Het
Mum1l1 G A X: 139,236,680 G656S possibly damaging Het
Nmnat2 G A 1: 153,112,425 V267I probably benign Het
Noc2l A G 4: 156,237,450 D102G probably benign Het
Ntn1 T C 11: 68,385,864 E86G probably benign Het
Olfr1214 A T 2: 88,987,320 I294K probably benign Het
Olfr231 A G 1: 174,117,732 Y95H probably damaging Het
Olfr664 A G 7: 104,734,218 F49L probably benign Het
Olfr715b T A 7: 107,106,468 H131L probably benign Het
Opn4 A G 14: 34,593,828 probably null Het
Pate3 T A 9: 35,648,119 M1L possibly damaging Het
Pex2 A G 3: 5,561,180 Y190H probably damaging Het
Pkhd1l1 A C 15: 44,540,871 T2299P probably damaging Het
Ppp6r3 A C 19: 3,521,782 S122R possibly damaging Het
Rnf113a1 A G X: 37,192,083 E231G probably damaging Het
Rnf41 T C 10: 128,438,154 L225P possibly damaging Het
Rreb1 G C 13: 37,932,453 A1263P probably benign Het
Rxfp1 A G 3: 79,682,471 V121A possibly damaging Het
Slc35e4 A T 11: 3,912,796 V131D probably damaging Het
Smyd4 T A 11: 75,390,136 M145K probably benign Het
Snx13 T A 12: 35,138,117 I798N probably benign Het
Srgap3 A T 6: 112,722,972 F1015Y probably damaging Het
Synj1 T C 16: 90,969,329 Y567C probably damaging Het
Tbc1d8 G A 1: 39,402,696 Q272* probably null Het
Tinf2 T C 14: 55,680,631 D127G probably damaging Het
Ube2v1 G A 2: 167,617,965 P39L probably damaging Het
Vegfd A G X: 164,385,883 E57G probably damaging Het
Vmn2r72 A T 7: 85,750,836 I335N probably damaging Het
Zc3h6 A G 2: 129,015,460 H633R probably benign Het
Other mutations in Il18r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Il18r1 APN 1 40498652 missense possibly damaging 0.68
IGL00742:Il18r1 APN 1 40480991 missense probably benign 0.11
IGL01448:Il18r1 APN 1 40474730 missense probably damaging 1.00
IGL01726:Il18r1 APN 1 40498403 missense possibly damaging 0.83
IGL02081:Il18r1 APN 1 40498505 missense probably damaging 1.00
IGL02425:Il18r1 APN 1 40491221 splice site probably benign
IGL02447:Il18r1 APN 1 40498337 critical splice acceptor site probably null
IGL02529:Il18r1 APN 1 40487059 missense possibly damaging 0.77
IGL02863:Il18r1 APN 1 40487007 missense probably damaging 1.00
IGL02928:Il18r1 APN 1 40478551 critical splice donor site probably null
IGL02941:Il18r1 APN 1 40498551 missense probably damaging 0.99
IGL03156:Il18r1 APN 1 40498368 missense possibly damaging 0.92
R0532:Il18r1 UTSW 1 40474901 missense probably damaging 0.97
R0926:Il18r1 UTSW 1 40487028 missense probably damaging 1.00
R1909:Il18r1 UTSW 1 40474914 missense probably damaging 1.00
R2212:Il18r1 UTSW 1 40491067 missense probably damaging 1.00
R2254:Il18r1 UTSW 1 40491220 missense possibly damaging 0.91
R2860:Il18r1 UTSW 1 40498557 missense possibly damaging 0.49
R2861:Il18r1 UTSW 1 40498557 missense possibly damaging 0.49
R3412:Il18r1 UTSW 1 40491067 missense probably damaging 1.00
R3432:Il18r1 UTSW 1 40487089 missense probably damaging 0.99
R3718:Il18r1 UTSW 1 40495788 missense probably benign 0.00
R3816:Il18r1 UTSW 1 40486972 splice site probably benign
R3894:Il18r1 UTSW 1 40474874 missense possibly damaging 0.79
R4061:Il18r1 UTSW 1 40474936 missense probably benign 0.33
R4062:Il18r1 UTSW 1 40474936 missense probably benign 0.33
R4381:Il18r1 UTSW 1 40471790 missense probably benign 0.00
R4972:Il18r1 UTSW 1 40491064 missense probably benign 0.39
R5059:Il18r1 UTSW 1 40481067 critical splice donor site probably null
R6229:Il18r1 UTSW 1 40474763 missense probably benign 0.02
R6458:Il18r1 UTSW 1 40491182 nonsense probably null
R6505:Il18r1 UTSW 1 40489707 missense probably benign
R6738:Il18r1 UTSW 1 40498656 missense probably benign 0.06
R7002:Il18r1 UTSW 1 40474853 missense probably benign 0.39
R7317:Il18r1 UTSW 1 40474832 missense possibly damaging 0.80
X0023:Il18r1 UTSW 1 40471761 missense probably benign 0.04
X0064:Il18r1 UTSW 1 40495713 intron probably null
Z1088:Il18r1 UTSW 1 40474751 missense probably damaging 1.00
Z1088:Il18r1 UTSW 1 40478486 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGCTAATCATCGTTCTCAGC -3'
(R):5'- CTTTTGAACCACAGCTACCGC -3'

Sequencing Primer
(F):5'- GCTAATCATCGTTCTCAGCCAGAG -3'
(R):5'- TACCGCTGTGAATAGGCAC -3'
Posted On2014-12-04