Incidental Mutation 'R2511:Cc2d2a'
ID252886
Institutional Source Beutler Lab
Gene Symbol Cc2d2a
Ensembl Gene ENSMUSG00000039765
Gene Namecoiled-coil and C2 domain containing 2A
Synonymsb2b1035Clo, 5730509K17Rik
MMRRC Submission 040417-MU
Accession Numbers

Genbank: NM_172274; MGI: 1924487

Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R2511 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location43662346-43740972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43735395 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1433 (Q1433L)
Ref Sequence ENSEMBL: ENSMUSP00000048320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]
Predicted Effect probably damaging
Transcript: ENSMUST00000048150
AA Change: Q1433L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: Q1433L

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
coiled coil region 472 501 N/A INTRINSIC
coiled coil region 553 582 N/A INTRINSIC
Pfam:CC2D2AN-C2 645 817 2e-36 PFAM
low complexity region 1005 1017 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
C2 1048 1208 3.43e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125866
AA Change: Q1372L

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: Q1372L

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 423 452 N/A INTRINSIC
coiled coil region 504 533 N/A INTRINSIC
Pfam:CC2D2AN-C2 596 768 7.7e-44 PFAM
low complexity region 970 982 N/A INTRINSIC
C2 994 1154 2.3e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
9330159F19Rik T A 10: 29,221,906 C100S probably damaging Het
Abcc8 C T 7: 46,150,780 R526H probably damaging Het
Acad10 G A 5: 121,631,567 P609S probably benign Het
Acod1 A T 14: 103,051,339 D95V probably damaging Het
Acsm5 A T 7: 119,530,454 I130F possibly damaging Het
Ago4 A T 4: 126,517,071 D208E probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Ankar A T 1: 72,658,694 I791K probably damaging Het
Ano10 A G 9: 122,258,945 V364A probably damaging Het
Arhgap9 T C 10: 127,328,985 probably null Het
Arsi G A 18: 60,916,594 C183Y probably damaging Het
Ascl2 T G 7: 142,968,216 E97A probably damaging Het
Asna1 A G 8: 85,019,766 V151A possibly damaging Het
Bcl2a1a C T 9: 88,957,453 R135W probably damaging Het
Bms1 C T 6: 118,391,153 probably null Het
Bysl T A 17: 47,604,335 T163S probably benign Het
Card10 A G 15: 78,780,273 I821T probably benign Het
Cchcr1 T C 17: 35,530,513 S809P probably benign Het
Ccz1 G T 5: 144,012,997 T70K probably damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cep164 A T 9: 45,775,249 L729Q probably damaging Het
Clcn6 A G 4: 148,017,494 probably null Het
Clcn7 T A 17: 25,155,446 V507E probably damaging Het
Ctso A C 3: 81,932,734 T24P probably damaging Het
Dis3l2 A T 1: 86,990,258 N543I probably benign Het
Dnah12 A T 14: 26,769,950 Y1114F possibly damaging Het
Emx1 A G 6: 85,204,051 D250G probably benign Het
Epha4 G A 1: 77,511,702 A47V possibly damaging Het
Fam149b A C 14: 20,378,456 N341T probably damaging Het
Fsip2 A G 2: 82,951,657 K62R probably damaging Het
Fsip2 T C 2: 82,986,438 S4172P probably benign Het
Gbp3 A G 3: 142,570,582 R480G probably benign Het
Gja8 T G 3: 96,919,717 T210P probably damaging Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Gm9930 T C 10: 9,534,702 noncoding transcript Het
Gstt4 C T 10: 75,815,125 C221Y probably benign Het
Gzmg A T 14: 56,158,375 D42E probably benign Het
Hoxd12 G A 2: 74,675,471 A129T possibly damaging Het
Hs2st1 G A 3: 144,569,930 probably benign Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Igsf10 T C 3: 59,331,866 D298G probably damaging Het
Irf1 T C 11: 53,773,791 V108A probably damaging Het
Jsrp1 C G 10: 80,812,306 S36T probably benign Het
Kcnq5 T A 1: 21,505,782 R233* probably null Het
Kif7 T C 7: 79,702,264 K917E probably damaging Het
Krt7 A C 15: 101,412,657 I62L probably benign Het
Lifr A G 15: 7,166,916 T194A probably benign Het
Ltbp2 T C 12: 84,804,409 probably null Het
Man2c1 A G 9: 57,141,388 probably null Het
Met T C 6: 17,491,967 S243P probably damaging Het
Mllt10 C A 2: 18,065,124 D30E possibly damaging Het
Mre11a A C 9: 14,795,769 probably null Het
Mroh9 A G 1: 163,038,945 S710P probably benign Het
Mvk C A 5: 114,450,398 Y116* probably null Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Ncf1 T C 5: 134,225,698 D184G probably damaging Het
Nxpe4 T C 9: 48,393,233 F207L probably damaging Het
Olfr10 T G 11: 49,318,221 L225R probably damaging Het
Olfr1137 T C 2: 87,711,048 N286S probably damaging Het
Olfr1301 T A 2: 111,754,316 N22K probably benign Het
Olfr1449 T A 19: 12,935,173 M145K possibly damaging Het
Olfr690 A T 7: 105,329,610 I194N probably damaging Het
Olfr700 G T 7: 106,805,961 P167H probably damaging Het
Pcdh1 G A 18: 38,199,479 T296M possibly damaging Het
Pcdh15 A G 10: 74,645,996 D391G possibly damaging Het
Pcdha7 C A 18: 36,974,733 D270E probably damaging Het
Pgam1 C A 19: 41,915,876 S137R probably damaging Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Plce1 T G 19: 38,760,054 I1729S probably damaging Het
Plppr4 G T 3: 117,331,706 N161K probably damaging Het
Prkce T A 17: 86,625,326 I578N probably damaging Het
Prss58 A C 6: 40,897,800 S36A probably damaging Het
Ptprm T C 17: 66,693,778 H1128R probably damaging Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rubcn T C 16: 32,847,254 N179S probably damaging Het
Sh3bp1 C T 15: 78,911,506 P612S probably damaging Het
Sh3bp5 G A 14: 31,411,629 T82M probably damaging Het
Shank2 A G 7: 144,411,577 Y974C probably damaging Het
Slc9c1 T C 16: 45,544,736 I144T possibly damaging Het
Slf2 T C 19: 44,941,606 I374T possibly damaging Het
Snx13 A G 12: 35,138,081 D786G probably benign Het
Spcs3 A G 8: 54,523,354 V151A possibly damaging Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Stac3 T C 10: 127,503,918 probably null Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tgm5 T C 2: 121,076,948 E98G possibly damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Tmem94 G A 11: 115,791,961 R608H probably damaging Het
Tnrc6a G A 7: 123,171,092 V702I probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Trim24 G A 6: 37,903,652 probably null Het
Ugt1a2 A G 1: 88,201,124 Y163C probably damaging Het
Vmn1r215 A G 13: 23,076,173 I128V probably benign Het
Vmn2r50 T A 7: 10,047,713 E368D possibly damaging Het
Vmn2r59 T C 7: 42,043,766 N470S probably damaging Het
Vps45 T C 3: 96,041,445 T333A probably benign Het
Zbtb44 T A 9: 31,054,243 D316E probably damaging Het
Zdhhc1 C T 8: 105,483,558 V76M probably benign Het
Zfp235 T C 7: 24,142,124 F656S probably damaging Het
Other mutations in Cc2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cc2d2a APN 5 43724380 splice site probably benign
IGL00937:Cc2d2a APN 5 43688122 critical splice acceptor site probably null
IGL01322:Cc2d2a APN 5 43689003 missense probably benign 0.00
IGL01349:Cc2d2a APN 5 43723784 missense probably benign 0.01
IGL01448:Cc2d2a APN 5 43684185 missense possibly damaging 0.65
IGL01871:Cc2d2a APN 5 43688969 missense probably damaging 0.98
IGL01947:Cc2d2a APN 5 43688237 missense probably damaging 0.96
IGL01976:Cc2d2a APN 5 43683115 missense probably benign 0.02
IGL02113:Cc2d2a APN 5 43685248 splice site probably null
IGL02364:Cc2d2a APN 5 43735450 missense probably damaging 1.00
IGL02448:Cc2d2a APN 5 43683205 splice site probably benign
IGL02458:Cc2d2a APN 5 43718554 missense probably benign 0.01
IGL02542:Cc2d2a APN 5 43688910 splice site probably benign
IGL02834:Cc2d2a APN 5 43714521 nonsense probably null
IGL02940:Cc2d2a APN 5 43728294 splice site probably null
IGL03003:Cc2d2a APN 5 43671266 missense probably benign 0.22
IGL03183:Cc2d2a APN 5 43732379 missense probably damaging 1.00
C9142:Cc2d2a UTSW 5 43735457 splice site probably benign
P0028:Cc2d2a UTSW 5 43684199 missense probably benign
R0193:Cc2d2a UTSW 5 43736118 missense probably damaging 1.00
R0201:Cc2d2a UTSW 5 43737512 missense probably damaging 1.00
R0211:Cc2d2a UTSW 5 43688266 splice site probably null
R0243:Cc2d2a UTSW 5 43696638 splice site probably benign
R0317:Cc2d2a UTSW 5 43706901 critical splice donor site probably null
R0453:Cc2d2a UTSW 5 43703294 missense probably benign 0.00
R0558:Cc2d2a UTSW 5 43724387 splice site probably benign
R0624:Cc2d2a UTSW 5 43730029 missense probably benign
R0634:Cc2d2a UTSW 5 43681381 splice site probably benign
R1503:Cc2d2a UTSW 5 43695239 missense probably damaging 1.00
R1635:Cc2d2a UTSW 5 43722470 missense probably damaging 1.00
R1686:Cc2d2a UTSW 5 43739371 missense possibly damaging 0.81
R1707:Cc2d2a UTSW 5 43723688 splice site probably null
R1715:Cc2d2a UTSW 5 43718661 missense probably damaging 0.97
R1765:Cc2d2a UTSW 5 43714531 missense probably damaging 0.99
R1794:Cc2d2a UTSW 5 43688252 missense probably damaging 1.00
R1881:Cc2d2a UTSW 5 43740828 missense probably damaging 0.99
R1917:Cc2d2a UTSW 5 43706222 missense probably damaging 1.00
R2005:Cc2d2a UTSW 5 43726373 critical splice donor site probably null
R2201:Cc2d2a UTSW 5 43684033 splice site probably benign
R2244:Cc2d2a UTSW 5 43732433 missense probably damaging 1.00
R2368:Cc2d2a UTSW 5 43703888 missense probably benign
R2442:Cc2d2a UTSW 5 43671305 critical splice donor site probably null
R3023:Cc2d2a UTSW 5 43685251 splice site probably null
R3147:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3148:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3426:Cc2d2a UTSW 5 43736109 missense probably benign 0.00
R3609:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3610:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3611:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3839:Cc2d2a UTSW 5 43718714 missense probably benign
R3870:Cc2d2a UTSW 5 43718691 nonsense probably null
R4334:Cc2d2a UTSW 5 43683134 missense probably benign 0.00
R4913:Cc2d2a UTSW 5 43739323 missense probably benign 0.12
R5179:Cc2d2a UTSW 5 43688221 missense possibly damaging 0.82
R5315:Cc2d2a UTSW 5 43720433 missense probably damaging 0.99
R5352:Cc2d2a UTSW 5 43706213 missense probably damaging 1.00
R5386:Cc2d2a UTSW 5 43730041 missense probably benign 0.01
R5538:Cc2d2a UTSW 5 43695176 missense possibly damaging 0.94
R5568:Cc2d2a UTSW 5 43709091 missense probably damaging 0.99
R5618:Cc2d2a UTSW 5 43729907 missense probably benign 0.00
R5653:Cc2d2a UTSW 5 43722462 missense possibly damaging 0.81
R5817:Cc2d2a UTSW 5 43712418 missense probably damaging 1.00
R5858:Cc2d2a UTSW 5 43715775 missense probably damaging 1.00
R5905:Cc2d2a UTSW 5 43712426 missense probably benign
R5912:Cc2d2a UTSW 5 43720430 missense probably damaging 0.97
R6073:Cc2d2a UTSW 5 43729975 missense probably damaging 1.00
R6084:Cc2d2a UTSW 5 43668673 missense probably benign
R6142:Cc2d2a UTSW 5 43703198 missense probably damaging 0.97
R6176:Cc2d2a UTSW 5 43709113 missense probably benign 0.32
R6238:Cc2d2a UTSW 5 43671235 missense probably benign 0.11
R6381:Cc2d2a UTSW 5 43715776 missense possibly damaging 0.69
R6404:Cc2d2a UTSW 5 43704074 missense possibly damaging 0.58
R6455:Cc2d2a UTSW 5 43739412 missense possibly damaging 0.69
R6695:Cc2d2a UTSW 5 43718677 missense probably damaging 0.99
R6805:Cc2d2a UTSW 5 43681331 missense probably damaging 1.00
R6919:Cc2d2a UTSW 5 43703215 missense probably benign 0.19
R6970:Cc2d2a UTSW 5 43718585 missense probably damaging 1.00
R7024:Cc2d2a UTSW 5 43733929 missense probably benign 0.10
R7054:Cc2d2a UTSW 5 43699979 nonsense probably null
R7071:Cc2d2a UTSW 5 43709113 missense probably benign 0.13
R7098:Cc2d2a UTSW 5 43683139 missense probably benign 0.00
R7366:Cc2d2a UTSW 5 43729990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACACAGGTAAAACATGATCG -3'
(R):5'- TCTGTACTCTTCTGAAGGTCAAGTAAC -3'

Sequencing Primer
(F):5'- CACACAGGTAAAACATGATCGTTTTG -3'
(R):5'- AAGTGGATACCTCTACCAATTCTGC -3'
Posted On2014-12-04