Incidental Mutation 'R2862:Olfr231'
ID252887
Institutional Source Beutler Lab
Gene Symbol Olfr231
Ensembl Gene ENSMUSG00000046486
Gene Nameolfactory receptor 231
SynonymsOlfr244, GA_x6K02T2LER7-6-623, Olfr425, GA_x6K02T2P20D-21053942-21054499, GA_x6K02T02K39-452-3, MOR105-4
MMRRC Submission 040452-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R2862 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location174113211-174121162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174117732 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 95 (Y95H)
Ref Sequence ENSEMBL: ENSMUSP00000151011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063030] [ENSMUST00000214446]
Predicted Effect probably damaging
Transcript: ENSMUST00000063030
AA Change: Y95H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059596
Gene: ENSMUSG00000046486
AA Change: Y95H

DomainStartEndE-ValueType
Pfam:7tm_4 24 300 2.6e-63 PFAM
Pfam:7tm_1 34 282 2.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214446
AA Change: Y95H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,485,911 probably benign Het
Abca13 A G 11: 9,309,057 S2928G probably damaging Het
Abcd1 T A X: 73,737,458 L713H probably damaging Het
Actg1 T C 11: 120,346,801 I52V probably benign Het
Ahi1 T A 10: 20,981,408 V634E probably damaging Het
Ang G T 14: 51,101,818 D139Y probably damaging Het
Apoe T C 7: 19,697,554 Y46C probably damaging Het
Aqr A T 2: 114,136,917 V539D probably damaging Het
Btg3 A G 16: 78,364,980 V114A probably damaging Het
Cap1 A T 4: 122,864,725 S221T probably benign Het
Cdca2 T C 14: 67,698,090 E392G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col22a1 A G 15: 71,815,943 probably null Het
Cyp2c38 G A 19: 39,460,694 R72W probably benign Het
Dnah1 C T 14: 31,284,762 G2199S probably benign Het
Dnhd1 A G 7: 105,712,559 E3608G probably benign Het
Ears2 A T 7: 122,062,940 L95Q probably damaging Het
F5 A T 1: 164,184,964 K482N probably damaging Het
Gata5 C T 2: 180,334,336 G12S possibly damaging Het
Gm11938 C A 11: 99,603,146 R41L probably damaging Het
Grap2 A T 15: 80,647,964 Q260L probably damaging Het
Greb1 A G 12: 16,711,745 S545P probably benign Het
Iglc1 T C 16: 19,061,910 probably benign Het
Il18r1 T C 1: 40,498,557 V494A possibly damaging Het
Kdf1 G A 4: 133,528,541 E190K probably damaging Het
Lama2 G A 10: 27,422,612 Q163* probably null Het
Lama3 G T 18: 12,453,750 L723F probably damaging Het
Lamp5 A T 2: 136,058,946 H22L probably benign Het
Maged1 G A X: 94,538,924 P366S probably damaging Het
Med14 A G X: 12,719,697 I521T probably benign Het
Mia2 A G 12: 59,154,410 K841E probably damaging Het
Mrgbp G A 2: 180,583,410 R53Q possibly damaging Het
Mrps18b G A 17: 35,910,854 S101L probably benign Het
Mum1l1 G A X: 139,236,680 G656S possibly damaging Het
Nmnat2 G A 1: 153,112,425 V267I probably benign Het
Noc2l A G 4: 156,237,450 D102G probably benign Het
Ntn1 T C 11: 68,385,864 E86G probably benign Het
Olfr1214 A T 2: 88,987,320 I294K probably benign Het
Olfr664 A G 7: 104,734,218 F49L probably benign Het
Olfr715b T A 7: 107,106,468 H131L probably benign Het
Opn4 A G 14: 34,593,828 probably null Het
Pate3 T A 9: 35,648,119 M1L possibly damaging Het
Pex2 A G 3: 5,561,180 Y190H probably damaging Het
Pkhd1l1 A C 15: 44,540,871 T2299P probably damaging Het
Ppp6r3 A C 19: 3,521,782 S122R possibly damaging Het
Rnf113a1 A G X: 37,192,083 E231G probably damaging Het
Rnf41 T C 10: 128,438,154 L225P possibly damaging Het
Rreb1 G C 13: 37,932,453 A1263P probably benign Het
Rxfp1 A G 3: 79,682,471 V121A possibly damaging Het
Slc35e4 A T 11: 3,912,796 V131D probably damaging Het
Smyd4 T A 11: 75,390,136 M145K probably benign Het
Snx13 T A 12: 35,138,117 I798N probably benign Het
Srgap3 A T 6: 112,722,972 F1015Y probably damaging Het
Synj1 T C 16: 90,969,329 Y567C probably damaging Het
Tbc1d8 G A 1: 39,402,696 Q272* probably null Het
Tinf2 T C 14: 55,680,631 D127G probably damaging Het
Ube2v1 G A 2: 167,617,965 P39L probably damaging Het
Vegfd A G X: 164,385,883 E57G probably damaging Het
Vmn2r72 A T 7: 85,750,836 I335N probably damaging Het
Zc3h6 A G 2: 129,015,460 H633R probably benign Het
Other mutations in Olfr231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01973:Olfr231 APN 1 174117533 missense probably damaging 1.00
IGL03126:Olfr231 APN 1 174117710 missense probably benign 0.07
R0200:Olfr231 UTSW 1 174117512 missense probably benign 0.00
R1292:Olfr231 UTSW 1 174117854 missense probably benign 0.16
R1966:Olfr231 UTSW 1 174117251 nonsense probably null
R2860:Olfr231 UTSW 1 174117732 missense probably damaging 1.00
R2861:Olfr231 UTSW 1 174117732 missense probably damaging 1.00
R4492:Olfr231 UTSW 1 174117204 missense probably benign 0.01
R4594:Olfr231 UTSW 1 174117320 missense probably damaging 0.96
R4670:Olfr231 UTSW 1 174117861 missense probably benign 0.04
R4703:Olfr231 UTSW 1 174117398 missense possibly damaging 0.52
R6385:Olfr231 UTSW 1 174117296 missense probably damaging 1.00
R7085:Olfr231 UTSW 1 174117660 missense probably damaging 1.00
Z1088:Olfr231 UTSW 1 174117315 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GGATCTTGTTGGAGCCACAG -3'
(R):5'- GAACCTAGTGATCTTTGTTGCTGTC -3'

Sequencing Primer
(F):5'- TCCATGCAATCTCAGGGAGTAC -3'
(R):5'- TCCAGCTGGACATGGCTCTG -3'
Posted On2014-12-04