Incidental Mutation 'R2511:Abcc8'
ID252925
Institutional Source Beutler Lab
Gene Symbol Abcc8
Ensembl Gene ENSMUSG00000040136
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 8
SynonymsD930031B21Rik, SUR1, Sur
MMRRC Submission 040417-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.541) question?
Stock #R2511 (G1)
Quality Score120
Status Not validated
Chromosome7
Chromosomal Location46104523-46180033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46150780 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 526 (R526H)
Ref Sequence ENSEMBL: ENSMUSP00000033123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033123]
Predicted Effect probably damaging
Transcript: ENSMUST00000033123
AA Change: R526H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033123
Gene: ENSMUSG00000040136
AA Change: R526H

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 131 148 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 299 590 1.3e-39 PFAM
AAA 705 920 4.46e-14 SMART
low complexity region 972 994 N/A INTRINSIC
Pfam:ABC_membrane 1019 1301 1.3e-49 PFAM
AAA 1377 1570 4.33e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210986
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a transient neonatal hypoglycemia and a late-developing glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
9330159F19Rik T A 10: 29,221,906 C100S probably damaging Het
Acad10 G A 5: 121,631,567 P609S probably benign Het
Acod1 A T 14: 103,051,339 D95V probably damaging Het
Acsm5 A T 7: 119,530,454 I130F possibly damaging Het
Ago4 A T 4: 126,517,071 D208E probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Ankar A T 1: 72,658,694 I791K probably damaging Het
Ano10 A G 9: 122,258,945 V364A probably damaging Het
Arhgap9 T C 10: 127,328,985 probably null Het
Arsi G A 18: 60,916,594 C183Y probably damaging Het
Ascl2 T G 7: 142,968,216 E97A probably damaging Het
Asna1 A G 8: 85,019,766 V151A possibly damaging Het
Bcl2a1a C T 9: 88,957,453 R135W probably damaging Het
Bms1 C T 6: 118,391,153 probably null Het
Bysl T A 17: 47,604,335 T163S probably benign Het
Card10 A G 15: 78,780,273 I821T probably benign Het
Cc2d2a A T 5: 43,735,395 Q1433L probably damaging Het
Cchcr1 T C 17: 35,530,513 S809P probably benign Het
Ccz1 G T 5: 144,012,997 T70K probably damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cep164 A T 9: 45,775,249 L729Q probably damaging Het
Clcn6 A G 4: 148,017,494 probably null Het
Clcn7 T A 17: 25,155,446 V507E probably damaging Het
Ctso A C 3: 81,932,734 T24P probably damaging Het
Dis3l2 A T 1: 86,990,258 N543I probably benign Het
Dnah12 A T 14: 26,769,950 Y1114F possibly damaging Het
Emx1 A G 6: 85,204,051 D250G probably benign Het
Epha4 G A 1: 77,511,702 A47V possibly damaging Het
Fam149b A C 14: 20,378,456 N341T probably damaging Het
Fsip2 A G 2: 82,951,657 K62R probably damaging Het
Fsip2 T C 2: 82,986,438 S4172P probably benign Het
Gbp3 A G 3: 142,570,582 R480G probably benign Het
Gja8 T G 3: 96,919,717 T210P probably damaging Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Gm9930 T C 10: 9,534,702 noncoding transcript Het
Gstt4 C T 10: 75,815,125 C221Y probably benign Het
Gzmg A T 14: 56,158,375 D42E probably benign Het
Hoxd12 G A 2: 74,675,471 A129T possibly damaging Het
Hs2st1 G A 3: 144,569,930 probably benign Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Igsf10 T C 3: 59,331,866 D298G probably damaging Het
Irf1 T C 11: 53,773,791 V108A probably damaging Het
Jsrp1 C G 10: 80,812,306 S36T probably benign Het
Kcnq5 T A 1: 21,505,782 R233* probably null Het
Kif7 T C 7: 79,702,264 K917E probably damaging Het
Krt7 A C 15: 101,412,657 I62L probably benign Het
Lifr A G 15: 7,166,916 T194A probably benign Het
Ltbp2 T C 12: 84,804,409 probably null Het
Man2c1 A G 9: 57,141,388 probably null Het
Met T C 6: 17,491,967 S243P probably damaging Het
Mllt10 C A 2: 18,065,124 D30E possibly damaging Het
Mre11a A C 9: 14,795,769 probably null Het
Mroh9 A G 1: 163,038,945 S710P probably benign Het
Mvk C A 5: 114,450,398 Y116* probably null Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Ncf1 T C 5: 134,225,698 D184G probably damaging Het
Nxpe4 T C 9: 48,393,233 F207L probably damaging Het
Olfr10 T G 11: 49,318,221 L225R probably damaging Het
Olfr1137 T C 2: 87,711,048 N286S probably damaging Het
Olfr1301 T A 2: 111,754,316 N22K probably benign Het
Olfr1449 T A 19: 12,935,173 M145K possibly damaging Het
Olfr690 A T 7: 105,329,610 I194N probably damaging Het
Olfr700 G T 7: 106,805,961 P167H probably damaging Het
Pcdh1 G A 18: 38,199,479 T296M possibly damaging Het
Pcdh15 A G 10: 74,645,996 D391G possibly damaging Het
Pcdha7 C A 18: 36,974,733 D270E probably damaging Het
Pgam1 C A 19: 41,915,876 S137R probably damaging Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Plce1 T G 19: 38,760,054 I1729S probably damaging Het
Plppr4 G T 3: 117,331,706 N161K probably damaging Het
Prkce T A 17: 86,625,326 I578N probably damaging Het
Prss58 A C 6: 40,897,800 S36A probably damaging Het
Ptprm T C 17: 66,693,778 H1128R probably damaging Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rubcn T C 16: 32,847,254 N179S probably damaging Het
Sh3bp1 C T 15: 78,911,506 P612S probably damaging Het
Sh3bp5 G A 14: 31,411,629 T82M probably damaging Het
Shank2 A G 7: 144,411,577 Y974C probably damaging Het
Slc9c1 T C 16: 45,544,736 I144T possibly damaging Het
Slf2 T C 19: 44,941,606 I374T possibly damaging Het
Snx13 A G 12: 35,138,081 D786G probably benign Het
Spcs3 A G 8: 54,523,354 V151A possibly damaging Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Stac3 T C 10: 127,503,918 probably null Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tgm5 T C 2: 121,076,948 E98G possibly damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Tmem94 G A 11: 115,791,961 R608H probably damaging Het
Tnrc6a G A 7: 123,171,092 V702I probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Trim24 G A 6: 37,903,652 probably null Het
Ugt1a2 A G 1: 88,201,124 Y163C probably damaging Het
Vmn1r215 A G 13: 23,076,173 I128V probably benign Het
Vmn2r50 T A 7: 10,047,713 E368D possibly damaging Het
Vmn2r59 T C 7: 42,043,766 N470S probably damaging Het
Vps45 T C 3: 96,041,445 T333A probably benign Het
Zbtb44 T A 9: 31,054,243 D316E probably damaging Het
Zdhhc1 C T 8: 105,483,558 V76M probably benign Het
Zfp235 T C 7: 24,142,124 F656S probably damaging Het
Other mutations in Abcc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Abcc8 APN 7 46104664 missense probably benign
IGL01457:Abcc8 APN 7 46135493 missense possibly damaging 0.51
IGL01645:Abcc8 APN 7 46115053 missense possibly damaging 0.93
IGL01683:Abcc8 APN 7 46151667 missense possibly damaging 0.78
IGL01826:Abcc8 APN 7 46124849 missense probably benign 0.01
IGL01912:Abcc8 APN 7 46120510 missense probably damaging 1.00
IGL02218:Abcc8 APN 7 46120436 missense probably benign 0.00
IGL02326:Abcc8 APN 7 46122857 critical splice donor site probably null
IGL02403:Abcc8 APN 7 46105803 splice site probably null
IGL02411:Abcc8 APN 7 46107007 missense probably damaging 1.00
IGL02653:Abcc8 APN 7 46115767
IGL02706:Abcc8 APN 7 46166921 missense probably benign 0.08
R0295:Abcc8 UTSW 7 46118054 missense probably benign
R0381:Abcc8 UTSW 7 46108434 missense possibly damaging 0.46
R0391:Abcc8 UTSW 7 46122173 missense probably damaging 0.98
R0408:Abcc8 UTSW 7 46107033 missense probably damaging 0.99
R0496:Abcc8 UTSW 7 46108820 missense probably damaging 1.00
R1126:Abcc8 UTSW 7 46109638 missense probably damaging 0.99
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1352:Abcc8 UTSW 7 46135468 splice site probably benign
R1368:Abcc8 UTSW 7 46122860 missense probably damaging 1.00
R1437:Abcc8 UTSW 7 46179813 missense probably damaging 1.00
R1463:Abcc8 UTSW 7 46154512 missense probably benign 0.12
R1689:Abcc8 UTSW 7 46120403 missense probably benign 0.16
R1717:Abcc8 UTSW 7 46115815 missense possibly damaging 0.91
R1804:Abcc8 UTSW 7 46120479 missense probably benign 0.02
R1848:Abcc8 UTSW 7 46166902 missense probably benign
R1870:Abcc8 UTSW 7 46123915 missense probably benign 0.05
R1938:Abcc8 UTSW 7 46175371 missense possibly damaging 0.49
R1993:Abcc8 UTSW 7 46117423 splice site probably null
R1994:Abcc8 UTSW 7 46157119 missense probably benign 0.02
R3840:Abcc8 UTSW 7 46108100 missense possibly damaging 0.67
R3879:Abcc8 UTSW 7 46104627 missense possibly damaging 0.90
R4444:Abcc8 UTSW 7 46136194 missense probably benign 0.09
R4463:Abcc8 UTSW 7 46106581 splice site probably null
R4761:Abcc8 UTSW 7 46113075 missense probably damaging 1.00
R4816:Abcc8 UTSW 7 46104707 missense probably benign 0.01
R4841:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4842:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4870:Abcc8 UTSW 7 46107259 nonsense probably null
R4969:Abcc8 UTSW 7 46105519 missense probably benign 0.02
R4975:Abcc8 UTSW 7 46150867 missense probably damaging 0.98
R5258:Abcc8 UTSW 7 46108387 missense probably benign
R5258:Abcc8 UTSW 7 46157148 missense probably benign 0.17
R5502:Abcc8 UTSW 7 46108838 missense probably benign 0.00
R5518:Abcc8 UTSW 7 46120449 missense probably benign
R5660:Abcc8 UTSW 7 46108404 missense probably benign 0.15
R5902:Abcc8 UTSW 7 46115039 missense probably benign
R5907:Abcc8 UTSW 7 46123906 missense probably benign 0.01
R6023:Abcc8 UTSW 7 46108419 missense possibly damaging 0.62
R6026:Abcc8 UTSW 7 46167000 missense probably benign
R6078:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6079:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6103:Abcc8 UTSW 7 46119021 missense possibly damaging 0.50
R6221:Abcc8 UTSW 7 46175450 missense probably benign 0.01
R6511:Abcc8 UTSW 7 46150861 missense possibly damaging 0.82
U15987:Abcc8 UTSW 7 46105844 missense probably benign 0.01
Z1088:Abcc8 UTSW 7 46138065 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGCTCTCAATTGCACAAGTG -3'
(R):5'- GGATTTGGTACCCTCTCCTCAG -3'

Sequencing Primer
(F):5'- ATGCCACTGGTATTCCAAGG -3'
(R):5'- TCTCCTCAGCCAAGCTAGG -3'
Posted On2014-12-04