Incidental Mutation 'R2862:Ahi1'
ID252940
Institutional Source Beutler Lab
Gene Symbol Ahi1
Ensembl Gene ENSMUSG00000019986
Gene NameAbelson helper integration site 1
Synonyms1700015F03Rik, Jouberin, D10Bwg0629e, Ahi-1
MMRRC Submission 040452-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.843) question?
Stock #R2862 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location20952547-21080429 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20981408 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 634 (V634E)
Ref Sequence ENSEMBL: ENSMUSP00000149010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105525] [ENSMUST00000213104]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105525
AA Change: V634E

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101164
Gene: ENSMUSG00000019986
AA Change: V634E

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
low complexity region 85 106 N/A INTRINSIC
low complexity region 148 159 N/A INTRINSIC
WD40 448 490 4.3e-1 SMART
WD40 493 532 9.3e-9 SMART
WD40 537 576 2.48e-4 SMART
WD40 583 622 6.09e-4 SMART
WD40 641 678 1.9e2 SMART
WD40 684 721 3.98e0 SMART
WD40 724 769 9.51e1 SMART
SH3 905 961 2.15e-21 SMART
low complexity region 975 989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213104
AA Change: V634E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is apparently required for both cerebellar and cortical development in humans. This gene mutations cause specific forms of Joubert syndrome-related disorders. Joubert syndrome (JS) is a recessively inherited developmental brain disorder with several identified causative chromosomal loci. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mouse embryonic fibroblasts homozygous for one knock-out allele exhibit reduced and abnormal cilia. Mice homozygous for another knock-out allele exhibit premature death and abnormal kidney morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,485,911 probably benign Het
Abca13 A G 11: 9,309,057 S2928G probably damaging Het
Abcd1 T A X: 73,737,458 L713H probably damaging Het
Actg1 T C 11: 120,346,801 I52V probably benign Het
Ang G T 14: 51,101,818 D139Y probably damaging Het
Apoe T C 7: 19,697,554 Y46C probably damaging Het
Aqr A T 2: 114,136,917 V539D probably damaging Het
Btg3 A G 16: 78,364,980 V114A probably damaging Het
Cap1 A T 4: 122,864,725 S221T probably benign Het
Cdca2 T C 14: 67,698,090 E392G probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col22a1 A G 15: 71,815,943 probably null Het
Cyp2c38 G A 19: 39,460,694 R72W probably benign Het
Dnah1 C T 14: 31,284,762 G2199S probably benign Het
Dnhd1 A G 7: 105,712,559 E3608G probably benign Het
Ears2 A T 7: 122,062,940 L95Q probably damaging Het
F5 A T 1: 164,184,964 K482N probably damaging Het
Gata5 C T 2: 180,334,336 G12S possibly damaging Het
Gm11938 C A 11: 99,603,146 R41L probably damaging Het
Grap2 A T 15: 80,647,964 Q260L probably damaging Het
Greb1 A G 12: 16,711,745 S545P probably benign Het
Iglc1 T C 16: 19,061,910 probably benign Het
Il18r1 T C 1: 40,498,557 V494A possibly damaging Het
Kdf1 G A 4: 133,528,541 E190K probably damaging Het
Lama2 G A 10: 27,422,612 Q163* probably null Het
Lama3 G T 18: 12,453,750 L723F probably damaging Het
Lamp5 A T 2: 136,058,946 H22L probably benign Het
Maged1 G A X: 94,538,924 P366S probably damaging Het
Med14 A G X: 12,719,697 I521T probably benign Het
Mia2 A G 12: 59,154,410 K841E probably damaging Het
Mrgbp G A 2: 180,583,410 R53Q possibly damaging Het
Mrps18b G A 17: 35,910,854 S101L probably benign Het
Mum1l1 G A X: 139,236,680 G656S possibly damaging Het
Nmnat2 G A 1: 153,112,425 V267I probably benign Het
Noc2l A G 4: 156,237,450 D102G probably benign Het
Ntn1 T C 11: 68,385,864 E86G probably benign Het
Olfr1214 A T 2: 88,987,320 I294K probably benign Het
Olfr231 A G 1: 174,117,732 Y95H probably damaging Het
Olfr664 A G 7: 104,734,218 F49L probably benign Het
Olfr715b T A 7: 107,106,468 H131L probably benign Het
Opn4 A G 14: 34,593,828 probably null Het
Pate3 T A 9: 35,648,119 M1L possibly damaging Het
Pex2 A G 3: 5,561,180 Y190H probably damaging Het
Pkhd1l1 A C 15: 44,540,871 T2299P probably damaging Het
Ppp6r3 A C 19: 3,521,782 S122R possibly damaging Het
Rnf113a1 A G X: 37,192,083 E231G probably damaging Het
Rnf41 T C 10: 128,438,154 L225P possibly damaging Het
Rreb1 G C 13: 37,932,453 A1263P probably benign Het
Rxfp1 A G 3: 79,682,471 V121A possibly damaging Het
Slc35e4 A T 11: 3,912,796 V131D probably damaging Het
Smyd4 T A 11: 75,390,136 M145K probably benign Het
Snx13 T A 12: 35,138,117 I798N probably benign Het
Srgap3 A T 6: 112,722,972 F1015Y probably damaging Het
Synj1 T C 16: 90,969,329 Y567C probably damaging Het
Tbc1d8 G A 1: 39,402,696 Q272* probably null Het
Tinf2 T C 14: 55,680,631 D127G probably damaging Het
Ube2v1 G A 2: 167,617,965 P39L probably damaging Het
Vegfd A G X: 164,385,883 E57G probably damaging Het
Vmn2r72 A T 7: 85,750,836 I335N probably damaging Het
Zc3h6 A G 2: 129,015,460 H633R probably benign Het
Other mutations in Ahi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ahi1 APN 10 20972141 missense probably damaging 1.00
IGL00914:Ahi1 APN 10 20984299 splice site probably null
IGL01075:Ahi1 APN 10 20987025 missense possibly damaging 0.80
IGL01094:Ahi1 APN 10 20972060 missense probably damaging 0.99
IGL01128:Ahi1 APN 10 21074433 missense probably benign
IGL01527:Ahi1 APN 10 20960085 splice site probably benign
IGL01821:Ahi1 APN 10 21041243 critical splice donor site probably null
IGL02159:Ahi1 APN 10 21058177 missense probably benign 0.13
IGL02176:Ahi1 APN 10 20970916 missense probably benign 0.00
IGL02200:Ahi1 APN 10 20981314 splice site probably benign
IGL02232:Ahi1 APN 10 20981375 missense probably damaging 1.00
IGL02305:Ahi1 APN 10 20970897 missense probably benign 0.00
IGL02323:Ahi1 APN 10 20972034 missense probably damaging 1.00
IGL02885:Ahi1 APN 10 21055113 missense possibly damaging 0.61
IGL02958:Ahi1 APN 10 20963799 missense probably damaging 1.00
IGL02971:Ahi1 APN 10 21000551 missense possibly damaging 0.93
IGL03109:Ahi1 APN 10 20970942 missense probably benign 0.00
IGL03192:Ahi1 APN 10 20965635 missense probably benign 0.00
IGL03377:Ahi1 APN 10 21018004 missense possibly damaging 0.51
P4717OSA:Ahi1 UTSW 10 20972110 missense probably damaging 1.00
P4748:Ahi1 UTSW 10 20972110 missense probably damaging 1.00
R0448:Ahi1 UTSW 10 20972075 missense probably damaging 1.00
R0559:Ahi1 UTSW 10 21000719 splice site probably benign
R0627:Ahi1 UTSW 10 20965522 missense probably benign 0.10
R0652:Ahi1 UTSW 10 20979461 missense probably damaging 1.00
R0690:Ahi1 UTSW 10 20970843 splice site probably benign
R1209:Ahi1 UTSW 10 20963730 missense probably damaging 0.98
R1364:Ahi1 UTSW 10 20972156 missense probably damaging 0.97
R1510:Ahi1 UTSW 10 20959800 missense probably benign 0.00
R1634:Ahi1 UTSW 10 20965693 missense probably damaging 1.00
R1789:Ahi1 UTSW 10 20963115 missense probably benign 0.18
R1818:Ahi1 UTSW 10 20988562 missense probably damaging 1.00
R2069:Ahi1 UTSW 10 20959996 missense probably damaging 0.98
R2148:Ahi1 UTSW 10 20970976 missense possibly damaging 0.64
R2566:Ahi1 UTSW 10 20970911 nonsense probably null
R2850:Ahi1 UTSW 10 21000593 missense probably benign 0.07
R3969:Ahi1 UTSW 10 20959947 missense probably damaging 1.00
R4430:Ahi1 UTSW 10 20972078 missense probably damaging 1.00
R4496:Ahi1 UTSW 10 20965545 missense probably benign 0.07
R4755:Ahi1 UTSW 10 21055047 missense possibly damaging 0.94
R4916:Ahi1 UTSW 10 20984404 missense probably damaging 1.00
R5216:Ahi1 UTSW 10 20960076 missense probably benign 0.00
R5223:Ahi1 UTSW 10 20970919 missense possibly damaging 0.79
R5224:Ahi1 UTSW 10 20987022 missense probably damaging 1.00
R5604:Ahi1 UTSW 10 20987005 missense probably damaging 1.00
R5665:Ahi1 UTSW 10 21055047 missense possibly damaging 0.94
R5704:Ahi1 UTSW 10 21074427 missense probably benign
R5769:Ahi1 UTSW 10 20960082 critical splice donor site probably null
R5899:Ahi1 UTSW 10 21000566 missense probably benign 0.06
R5936:Ahi1 UTSW 10 20965933 missense probably damaging 1.00
R5969:Ahi1 UTSW 10 20984393 missense probably damaging 1.00
R6066:Ahi1 UTSW 10 20959926 missense possibly damaging 0.84
R6122:Ahi1 UTSW 10 21058165 missense probably benign 0.26
R6135:Ahi1 UTSW 10 20969121 missense probably benign 0.01
R6240:Ahi1 UTSW 10 20977081 missense probably damaging 1.00
R6387:Ahi1 UTSW 10 20969043 missense probably damaging 1.00
R6395:Ahi1 UTSW 10 20979592 missense possibly damaging 0.49
R6406:Ahi1 UTSW 10 20977049 missense probably damaging 1.00
R6440:Ahi1 UTSW 10 20960082 critical splice donor site probably benign
R6558:Ahi1 UTSW 10 20963673 missense probably damaging 1.00
R6744:Ahi1 UTSW 10 20965567 missense probably damaging 1.00
R6755:Ahi1 UTSW 10 21017913 missense probably damaging 0.98
R6927:Ahi1 UTSW 10 21055069 missense probably damaging 1.00
R6932:Ahi1 UTSW 10 20963691 missense probably benign 0.02
R6967:Ahi1 UTSW 10 20988625 missense probably damaging 0.98
R7168:Ahi1 UTSW 10 21017932 missense probably benign 0.01
R7169:Ahi1 UTSW 10 21055019 missense probably damaging 1.00
R7327:Ahi1 UTSW 10 20987077 missense probably damaging 0.99
R7351:Ahi1 UTSW 10 20965933 missense probably damaging 1.00
X0024:Ahi1 UTSW 10 21000592 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AACATGACAAATGGAAATGTTATCCA -3'
(R):5'- GTATGAGGTGGGCTTCTGCA -3'

Sequencing Primer
(F):5'- TCCAATAGCTGACTGTGAGC -3'
(R):5'- CTGCACCGAGAGAAGCTTAAGTTTTC -3'
Posted On2014-12-04