Incidental Mutation 'R2863:Ppp4c'
ID253029
Institutional Source Beutler Lab
Gene Symbol Ppp4c
Ensembl Gene ENSMUSG00000030697
Gene Nameprotein phosphatase 4, catalytic subunit
Synonyms1110002D08Rik, PPX
MMRRC Submission 040453-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2863 (G1)
Quality Score129
Status Not validated
Chromosome7
Chromosomal Location126785866-126792496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126792100 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 20 (I20N)
Ref Sequence ENSEMBL: ENSMUSP00000146245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032934] [ENSMUST00000032936] [ENSMUST00000087566] [ENSMUST00000106348] [ENSMUST00000133514] [ENSMUST00000141355] [ENSMUST00000151137] [ENSMUST00000205336] [ENSMUST00000205786] [ENSMUST00000205890] [ENSMUST00000205935] [ENSMUST00000206353] [ENSMUST00000206570]
Predicted Effect probably benign
Transcript: ENSMUST00000032934
SMART Domains Protein: ENSMUSP00000032934
Gene: ENSMUSG00000030695

DomainStartEndE-ValueType
Pfam:Glycolytic 15 364 1.2e-179 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000032936
AA Change: I20N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032936
Gene: ENSMUSG00000030697
AA Change: I20N

DomainStartEndE-ValueType
PP2Ac 20 290 4.04e-147 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087566
SMART Domains Protein: ENSMUSP00000084846
Gene: ENSMUSG00000030695

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Glycolytic 69 418 2.8e-193 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106348
SMART Domains Protein: ENSMUSP00000101955
Gene: ENSMUSG00000030695

DomainStartEndE-ValueType
Pfam:Glycolytic 15 364 1.2e-179 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133514
SMART Domains Protein: ENSMUSP00000114587
Gene: ENSMUSG00000030695

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Glycolytic 69 193 5.4e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139657
Predicted Effect probably benign
Transcript: ENSMUST00000141355
SMART Domains Protein: ENSMUSP00000117349
Gene: ENSMUSG00000030695

DomainStartEndE-ValueType
Pfam:Glycolytic 15 131 7.5e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147748
Predicted Effect probably benign
Transcript: ENSMUST00000151137
SMART Domains Protein: ENSMUSP00000118417
Gene: ENSMUSG00000030695

DomainStartEndE-ValueType
Pfam:Glycolytic 15 237 6.9e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205336
Predicted Effect probably benign
Transcript: ENSMUST00000205786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205879
Predicted Effect probably benign
Transcript: ENSMUST00000205890
Predicted Effect possibly damaging
Transcript: ENSMUST00000205935
AA Change: I20N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206261
Predicted Effect unknown
Transcript: ENSMUST00000206334
AA Change: I16N
Predicted Effect probably benign
Transcript: ENSMUST00000206353
Predicted Effect probably benign
Transcript: ENSMUST00000206477
Predicted Effect probably damaging
Transcript: ENSMUST00000206570
AA Change: I20N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.498 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryonic Ppp4c-deficiency leads to early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A T 19: 45,885,957 N592K probably damaging Het
Bag5 T C 12: 111,710,595 T265A probably benign Het
Bmper A G 9: 23,483,941 N656S probably benign Het
Boc A G 16: 44,492,960 S514P probably benign Het
Ccdc114 T C 7: 45,948,312 S549P probably benign Het
Ddx6 G T 9: 44,614,256 L103F probably damaging Het
Epb41l3 C T 17: 69,210,321 P115S probably benign Het
Exoc6 T C 19: 37,653,413 F709S probably benign Het
Fnip1 T C 11: 54,502,424 I562T probably damaging Het
Fxr2 T A 11: 69,639,427 I40N probably damaging Het
Ifna6 G C 4: 88,827,862 R149S probably benign Het
Ifna6 C A 4: 88,827,849 T145K probably benign Het
Ldb2 T C 5: 44,480,324 Q214R probably damaging Het
Mus81 T G 19: 5,486,500 Y146S probably damaging Het
Myh11 T C 16: 14,239,426 I335V probably benign Het
Nid2 G A 14: 19,768,403 E322K possibly damaging Het
Ofcc1 A T 13: 40,072,760 S765R probably damaging Het
Ofcc1 T A 13: 40,087,938 H698L possibly damaging Het
Olfr923 T A 9: 38,828,539 F283I possibly damaging Het
Otog T G 7: 46,269,306 C935W probably damaging Het
Pcdhga3 T C 18: 37,674,590 V32A probably damaging Het
Phc3 C T 3: 30,914,128 D920N probably damaging Het
Pou6f1 A G 15: 100,580,808 probably null Het
Prkag2 T A 5: 25,021,792 T156S probably benign Het
Psd T C 19: 46,314,762 D95G probably damaging Het
Riox2 A G 16: 59,489,393 D370G probably damaging Het
Spink14 T A 18: 44,030,881 C39S probably damaging Het
Tdrd9 T C 12: 112,031,261 V728A probably benign Het
Tgm2 T C 2: 158,143,099 E29G probably benign Het
Wdr35 T A 12: 9,028,060 Y1139* probably null Het
Wdr95 T A 5: 149,581,856 C367* probably null Het
Zfp35 T A 18: 24,004,295 D565E probably damaging Het
Other mutations in Ppp4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0030:Ppp4c UTSW 7 126788433 missense possibly damaging 0.93
R0601:Ppp4c UTSW 7 126787288 missense probably benign 0.01
R0602:Ppp4c UTSW 7 126789082 splice site probably benign
R1187:Ppp4c UTSW 7 126786200 missense probably benign 0.02
R1244:Ppp4c UTSW 7 126786280 missense probably damaging 0.96
R1346:Ppp4c UTSW 7 126792050 splice site probably benign
R1878:Ppp4c UTSW 7 126787607 missense probably damaging 1.00
R1892:Ppp4c UTSW 7 126786280 missense probably damaging 0.96
R2072:Ppp4c UTSW 7 126787348 critical splice acceptor site probably null
R2313:Ppp4c UTSW 7 126787457 missense probably damaging 0.99
R2865:Ppp4c UTSW 7 126792100 missense probably damaging 0.98
R3808:Ppp4c UTSW 7 126787327 missense probably damaging 1.00
R3809:Ppp4c UTSW 7 126787327 missense probably damaging 1.00
R4290:Ppp4c UTSW 7 126792059 critical splice donor site probably null
R4504:Ppp4c UTSW 7 126787465 missense probably damaging 1.00
R5001:Ppp4c UTSW 7 126787537 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCAAGCCATTTTCCCTG -3'
(R):5'- TAATTGTCCGAGGCCCCTCTAG -3'

Sequencing Primer
(F):5'- GGCAAGCCATTTTCCCTGAGTTC -3'
(R):5'- TAGGCCACCGTCCTTAGC -3'
Posted On2014-12-04