Incidental Mutation 'R2864:Arhgap30'
ID253081
Institutional Source Beutler Lab
Gene Symbol Arhgap30
Ensembl Gene ENSMUSG00000048865
Gene NameRho GTPase activating protein 30
Synonyms6030405P05Rik
Accession Numbers

Ncbi RefSeq: NM_001005508.2; MGI: 2684948

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2864 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171388954-171410298 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 171408206 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 716 (G716V)
Ref Sequence ENSEMBL: ENSMUSP00000059389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001284] [ENSMUST00000056449] [ENSMUST00000159207] [ENSMUST00000160486] [ENSMUST00000161241] [ENSMUST00000167546]
Predicted Effect probably benign
Transcript: ENSMUST00000001284
Predicted Effect probably damaging
Transcript: ENSMUST00000056449
AA Change: G716V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059389
Gene: ENSMUSG00000048865
AA Change: G716V

DomainStartEndE-ValueType
low complexity region 6 14 N/A INTRINSIC
RhoGAP 31 212 1.4e-61 SMART
Blast:RhoGAP 225 285 2e-24 BLAST
low complexity region 348 366 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
low complexity region 498 510 N/A INTRINSIC
low complexity region 514 534 N/A INTRINSIC
low complexity region 667 690 N/A INTRINSIC
low complexity region 736 752 N/A INTRINSIC
low complexity region 924 940 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135312
Predicted Effect probably benign
Transcript: ENSMUST00000159207
SMART Domains Protein: ENSMUSP00000124000
Gene: ENSMUSG00000026641

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160335
Predicted Effect probably benign
Transcript: ENSMUST00000160486
SMART Domains Protein: ENSMUSP00000125363
Gene: ENSMUSG00000026641

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
HLH 205 260 5.01e-15 SMART
low complexity region 265 281 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161241
SMART Domains Protein: ENSMUSP00000125729
Gene: ENSMUSG00000026641

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
HLH 205 260 5.01e-15 SMART
low complexity region 265 281 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161297
Predicted Effect probably benign
Transcript: ENSMUST00000167546
SMART Domains Protein: ENSMUSP00000128913
Gene: ENSMUSG00000026641

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
HLH 205 260 5.01e-15 SMART
low complexity region 265 281 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Crk T C 11: 75,703,385 V266A probably damaging Het
Dock4 T A 12: 40,730,073 F624L probably damaging Het
Fhod1 T C 8: 105,332,911 K714R probably null Het
Flt1 T C 5: 147,594,621 Q844R possibly damaging Het
Fn1 A G 1: 71,602,419 V1656A probably damaging Het
Fnip1 T C 11: 54,502,424 I562T probably damaging Het
Gm7168 A G 17: 13,949,855 K495E probably benign Het
Gm884 A G 11: 103,540,918 F1357S probably benign Het
Igf2r T C 17: 12,686,724 H2240R probably damaging Het
Itpr3 T C 17: 27,091,551 V436A probably benign Het
Lrp1b G T 2: 40,874,995 Q2826K possibly damaging Het
Luc7l C A 17: 26,266,361 Q112K probably damaging Het
Misp A G 10: 79,827,038 K430E probably benign Het
Olfr902 A G 9: 38,449,388 N172S possibly damaging Het
Oprm1 T A 10: 6,794,226 probably null Het
Paqr3 C T 5: 97,099,736 R171H possibly damaging Het
Phc3 C T 3: 30,914,128 D920N probably damaging Het
Pigk T C 3: 152,722,552 V72A probably damaging Het
Prickle1 C T 15: 93,509,278 G112R probably damaging Het
Rrbp1 T C 2: 143,957,637 E1050G probably damaging Het
Vmn2r93 A T 17: 18,326,061 I732F probably damaging Het
Xkr6 T C 14: 63,819,756 L372P unknown Het
Zfp523 T C 17: 28,202,540 V60A probably benign Het
Other mutations in Arhgap30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Arhgap30 APN 1 171397570 missense probably damaging 1.00
IGL02016:Arhgap30 APN 1 171407747 missense probably damaging 1.00
IGL02552:Arhgap30 APN 1 171407756 missense probably damaging 1.00
IGL03343:Arhgap30 APN 1 171409094 missense probably damaging 1.00
FR4304:Arhgap30 UTSW 1 171405168 small insertion probably benign
P0017:Arhgap30 UTSW 1 171408704 missense probably benign 0.02
R0045:Arhgap30 UTSW 1 171408430 missense probably benign
R0045:Arhgap30 UTSW 1 171408430 missense probably benign
R0115:Arhgap30 UTSW 1 171407948 missense possibly damaging 0.92
R0320:Arhgap30 UTSW 1 171403804 missense possibly damaging 0.81
R0399:Arhgap30 UTSW 1 171404816 missense probably damaging 0.97
R0945:Arhgap30 UTSW 1 171403286 missense probably damaging 1.00
R1484:Arhgap30 UTSW 1 171403271 missense probably damaging 1.00
R1595:Arhgap30 UTSW 1 171408341 missense probably benign
R2173:Arhgap30 UTSW 1 171407767 missense probably damaging 1.00
R2281:Arhgap30 UTSW 1 171389328 missense probably damaging 1.00
R4066:Arhgap30 UTSW 1 171408323 missense probably benign
R4888:Arhgap30 UTSW 1 171409312 missense probably benign
R4937:Arhgap30 UTSW 1 171403329 missense probably benign 0.03
R4944:Arhgap30 UTSW 1 171402254 missense probably damaging 1.00
R5170:Arhgap30 UTSW 1 171408050 missense probably benign 0.00
R5218:Arhgap30 UTSW 1 171408760 missense probably benign
R5385:Arhgap30 UTSW 1 171408280 missense probably benign
R5541:Arhgap30 UTSW 1 171404139 critical splice donor site probably null
R6028:Arhgap30 UTSW 1 171408320 missense probably benign
R6747:Arhgap30 UTSW 1 171407729 missense probably damaging 1.00
R6748:Arhgap30 UTSW 1 171404810 missense possibly damaging 0.50
R6869:Arhgap30 UTSW 1 171409055 missense probably damaging 1.00
R7223:Arhgap30 UTSW 1 171407571 missense probably damaging 1.00
X0020:Arhgap30 UTSW 1 171405085 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CCCCGGAGCACATCAGATAA -3'
(R):5'- AAGGTCACTCTTCCTCCTCAG -3'

Sequencing Primer
(F):5'- GAGCACATCAGATAACCGGG -3'
(R):5'- ATGCTTGTGGACAACTTCCCAG -3'
Posted On2014-12-04