Incidental Mutation 'R0313:Cobll1'
ID25309
Institutional Source Beutler Lab
Gene Symbol Cobll1
Ensembl Gene ENSMUSG00000034903
Gene NameCobl-like 1
SynonymsD430044D16Rik, Coblr1
MMRRC Submission 038523-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R0313 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location65088339-65239403 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 65095744 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1195 (R1195*)
Ref Sequence ENSEMBL: ENSMUSP00000108050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090896] [ENSMUST00000102726] [ENSMUST00000112429] [ENSMUST00000112430] [ENSMUST00000112431]
Predicted Effect probably null
Transcript: ENSMUST00000090896
AA Change: R1157*
SMART Domains Protein: ENSMUSP00000088412
Gene: ENSMUSG00000034903
AA Change: R1157*

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 1.3e-38 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 426 438 N/A INTRINSIC
low complexity region 1023 1034 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102726
AA Change: R1194*
SMART Domains Protein: ENSMUSP00000099787
Gene: ENSMUSG00000034903
AA Change: R1194*

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 5.6e-39 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1060 1071 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112429
AA Change: R1195*
SMART Domains Protein: ENSMUSP00000108048
Gene: ENSMUSG00000034903
AA Change: R1195*

DomainStartEndE-ValueType
Pfam:Cobl 148 239 5.4e-49 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1061 1072 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112430
AA Change: R1156*
SMART Domains Protein: ENSMUSP00000108049
Gene: ENSMUSG00000034903
AA Change: R1156*

DomainStartEndE-ValueType
low complexity region 146 157 N/A INTRINSIC
Pfam:Cobl 185 263 1.3e-38 PFAM
low complexity region 331 342 N/A INTRINSIC
low complexity region 425 437 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112431
AA Change: R1195*
SMART Domains Protein: ENSMUSP00000108050
Gene: ENSMUSG00000034903
AA Change: R1195*

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 5.6e-39 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1061 1072 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155768
Meta Mutation Damage Score 0.63 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.9%
  • 20x: 88.5%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 A G 6: 58,672,097 E309G probably benign Het
AI314180 A G 4: 58,811,892 I1411T probably benign Het
Ankmy1 C T 1: 92,886,221 G412D probably damaging Het
Cc2d1a G A 8: 84,136,969 T542I probably benign Het
Cldn18 T C 9: 99,698,914 I94V probably benign Het
Dnah7b A G 1: 46,207,643 T1660A probably damaging Het
Dzip3 G T 16: 48,937,061 Q870K probably damaging Het
Ebf4 T C 2: 130,306,787 probably benign Het
Esyt2 T C 12: 116,347,808 L439P probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Haspin A G 11: 73,136,298 V655A probably damaging Het
Kmt2c T C 5: 25,344,930 E1351G probably damaging Het
Lama2 C A 10: 26,993,398 probably null Het
Lcp1 A G 14: 75,199,433 E73G probably damaging Het
Ltv1 C T 10: 13,182,860 probably null Het
Mcmdc2 A G 1: 9,932,141 Y529C probably damaging Het
Myo3b T A 2: 70,348,959 Y1172* probably null Het
Ncf1 T C 5: 134,229,567 M1V probably null Het
Olfr1297 C T 2: 111,621,600 S158N possibly damaging Het
Olfr250 T C 9: 38,368,304 S243P probably damaging Het
Olfr765 A G 10: 129,046,826 V79A possibly damaging Het
Pcif1 A T 2: 164,884,419 H80L probably damaging Het
Pclo T C 5: 14,678,873 probably benign Het
Polr2a T C 11: 69,735,080 Y1710C unknown Het
Ppp1r37 G A 7: 19,533,998 T324I probably damaging Het
Prmt1 T C 7: 44,978,748 D176G probably benign Het
Scn5a T C 9: 119,534,571 D501G probably damaging Het
Ska2 A G 11: 87,117,814 I89M possibly damaging Het
Slc39a7 G A 17: 34,029,544 A375V probably damaging Het
Ssrp1 T A 2: 85,041,554 I374N probably damaging Het
Stox2 C T 8: 47,192,134 G828R probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Uqcrc1 C A 9: 108,948,574 R114S possibly damaging Het
Usp38 A T 8: 80,984,442 L988* probably null Het
Vmn2r5 T A 3: 64,503,827 H440L probably benign Het
Wdr12 A T 1: 60,082,579 I271N possibly damaging Het
Xylt2 C T 11: 94,669,894 probably benign Het
Other mutations in Cobll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Cobll1 APN 2 65126013 missense probably damaging 1.00
IGL01074:Cobll1 APN 2 65107848 missense probably damaging 1.00
IGL01093:Cobll1 APN 2 65098237 missense probably damaging 1.00
IGL02411:Cobll1 APN 2 65097740 missense probably damaging 1.00
IGL02419:Cobll1 APN 2 65151048 missense probably damaging 1.00
IGL02550:Cobll1 APN 2 65107863 missense probably damaging 1.00
IGL02607:Cobll1 APN 2 65151085 missense probably damaging 0.98
IGL02829:Cobll1 APN 2 65126045 missense probably damaging 1.00
IGL02802:Cobll1 UTSW 2 65098319 missense probably damaging 0.99
R0314:Cobll1 UTSW 2 65089521 missense possibly damaging 0.81
R0322:Cobll1 UTSW 2 65102098 missense possibly damaging 0.84
R0846:Cobll1 UTSW 2 65102065 splice site probably null
R1163:Cobll1 UTSW 2 65098279 missense probably damaging 0.96
R1242:Cobll1 UTSW 2 65151169 critical splice acceptor site probably null
R1364:Cobll1 UTSW 2 65126310 splice site probably benign
R1445:Cobll1 UTSW 2 65099136 missense probably damaging 1.00
R1610:Cobll1 UTSW 2 65133642 missense probably damaging 1.00
R1836:Cobll1 UTSW 2 65126236 missense probably damaging 1.00
R2102:Cobll1 UTSW 2 65098210 missense probably damaging 1.00
R3154:Cobll1 UTSW 2 65107050 missense probably benign 0.00
R4580:Cobll1 UTSW 2 65151073 missense probably benign 0.00
R4638:Cobll1 UTSW 2 65099237 missense probably benign 0.03
R4684:Cobll1 UTSW 2 65099028 missense possibly damaging 0.90
R4906:Cobll1 UTSW 2 65097693 missense probably benign 0.01
R4923:Cobll1 UTSW 2 65099258 missense possibly damaging 0.87
R5100:Cobll1 UTSW 2 65125901 missense probably benign 0.26
R5269:Cobll1 UTSW 2 65133771 nonsense probably null
R5419:Cobll1 UTSW 2 65103357 missense possibly damaging 0.57
R5637:Cobll1 UTSW 2 65125903 missense possibly damaging 0.90
R5745:Cobll1 UTSW 2 65098457 missense probably damaging 0.99
R5777:Cobll1 UTSW 2 65103268 missense probably benign 0.27
R6303:Cobll1 UTSW 2 65098033 missense possibly damaging 0.68
R6471:Cobll1 UTSW 2 65107884 missense probably damaging 1.00
X0020:Cobll1 UTSW 2 65103322 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGCGCAATAGAGTCTCTCTTACAATG -3'
(R):5'- GGTGGCACCTTTCTTGCATATGATCC -3'

Sequencing Primer
(F):5'- ATGAGAATTCAGGCTACCTTCC -3'
(R):5'- GAAGGTAGATCATTGATCTCCCAGC -3'
Posted On2013-04-16