Incidental Mutation 'R2864:Prickle1'
ID253119
Institutional Source Beutler Lab
Gene Symbol Prickle1
Ensembl Gene ENSMUSG00000036158
Gene Nameprickle planar cell polarity protein 1
Synonyms1110058P22Rik, b2b019Clo, mpk1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2864 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location93499114-93595891 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93509278 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 112 (G112R)
Ref Sequence ENSEMBL: ENSMUSP00000104878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048982] [ENSMUST00000109255]
Predicted Effect probably damaging
Transcript: ENSMUST00000048982
AA Change: G112R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049204
Gene: ENSMUSG00000036158
AA Change: G112R

DomainStartEndE-ValueType
Pfam:PET 16 116 2.2e-46 PFAM
LIM 125 182 1.73e-9 SMART
LIM 190 242 1.13e-13 SMART
LIM 250 305 2.37e-7 SMART
low complexity region 314 343 N/A INTRINSIC
low complexity region 667 684 N/A INTRINSIC
low complexity region 758 776 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109255
AA Change: G112R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104878
Gene: ENSMUSG00000036158
AA Change: G112R

DomainStartEndE-ValueType
Pfam:PET 13 118 3.7e-46 PFAM
LIM 125 182 1.73e-9 SMART
LIM 190 242 1.13e-13 SMART
LIM 250 305 2.37e-7 SMART
low complexity region 314 343 N/A INTRINSIC
low complexity region 667 684 N/A INTRINSIC
low complexity region 758 776 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear receptor that may be a negative regulator of the Wnt/beta-catenin signaling pathway. The encoded protein localizes to the nuclear membrane and has been implicated in the nuclear trafficking of the transcription repressors REST/NRSF and REST4. Mutations in this gene have been linked to progressive myoclonus epilepsy. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Sep 2009]
PHENOTYPE: Heterozygous null or point mutations result in decreased seizure threshold. Homozygous null mice display early embryonic lethality associated with altered epiblast apical-basal polarity, failed anterior migration of the distal visceral endoderm, and lackof mesoderm and primitive streak formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap30 G T 1: 171,408,206 G716V probably damaging Het
Crk T C 11: 75,703,385 V266A probably damaging Het
Dock4 T A 12: 40,730,073 F624L probably damaging Het
Fhod1 T C 8: 105,332,911 K714R probably null Het
Flt1 T C 5: 147,594,621 Q844R possibly damaging Het
Fn1 A G 1: 71,602,419 V1656A probably damaging Het
Fnip1 T C 11: 54,502,424 I562T probably damaging Het
Gm7168 A G 17: 13,949,855 K495E probably benign Het
Gm884 A G 11: 103,540,918 F1357S probably benign Het
Igf2r T C 17: 12,686,724 H2240R probably damaging Het
Itpr3 T C 17: 27,091,551 V436A probably benign Het
Lrp1b G T 2: 40,874,995 Q2826K possibly damaging Het
Luc7l C A 17: 26,266,361 Q112K probably damaging Het
Misp A G 10: 79,827,038 K430E probably benign Het
Olfr902 A G 9: 38,449,388 N172S possibly damaging Het
Oprm1 T A 10: 6,794,226 probably null Het
Paqr3 C T 5: 97,099,736 R171H possibly damaging Het
Phc3 C T 3: 30,914,128 D920N probably damaging Het
Pigk T C 3: 152,722,552 V72A probably damaging Het
Rrbp1 T C 2: 143,957,637 E1050G probably damaging Het
Vmn2r93 A T 17: 18,326,061 I732F probably damaging Het
Xkr6 T C 14: 63,819,756 L372P unknown Het
Zfp523 T C 17: 28,202,540 V60A probably benign Het
Other mutations in Prickle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Prickle1 APN 15 93500781 missense probably benign 0.29
IGL01641:Prickle1 APN 15 93500572 missense probably benign 0.05
IGL01917:Prickle1 APN 15 93503527 missense probably damaging 0.99
IGL02124:Prickle1 APN 15 93503146 missense probably damaging 1.00
IGL02754:Prickle1 APN 15 93501153 missense possibly damaging 0.94
P0028:Prickle1 UTSW 15 93500902 missense probably damaging 1.00
R0134:Prickle1 UTSW 15 93510777 missense possibly damaging 0.63
R0189:Prickle1 UTSW 15 93503019 nonsense probably null
R0225:Prickle1 UTSW 15 93510777 missense possibly damaging 0.63
R0556:Prickle1 UTSW 15 93500781 missense probably benign 0.29
R1144:Prickle1 UTSW 15 93512461 missense probably damaging 0.99
R1440:Prickle1 UTSW 15 93505074 missense possibly damaging 0.85
R1458:Prickle1 UTSW 15 93500638 missense probably damaging 1.00
R2420:Prickle1 UTSW 15 93503637 missense probably damaging 1.00
R2656:Prickle1 UTSW 15 93503370 missense probably benign 0.32
R4301:Prickle1 UTSW 15 93508636 missense possibly damaging 0.82
R4912:Prickle1 UTSW 15 93500548 missense probably benign 0.00
R5085:Prickle1 UTSW 15 93500902 missense probably damaging 1.00
R5773:Prickle1 UTSW 15 93508597 missense probably damaging 1.00
R5836:Prickle1 UTSW 15 93503017 nonsense probably null
R5902:Prickle1 UTSW 15 93510672 missense probably null 0.82
R7022:Prickle1 UTSW 15 93500871 missense possibly damaging 0.82
X0066:Prickle1 UTSW 15 93503194 missense probably benign 0.00
X0067:Prickle1 UTSW 15 93508681 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CGTTCAATGAGACCGACTCC -3'
(R):5'- CATGCCAACTGAGGGTTAGAG -3'

Sequencing Primer
(F):5'- TTCAATGAGACCGACTCCTGTGG -3'
(R):5'- GCAGCTAGGCTTCCCTGTTTG -3'
Posted On2014-12-04