Incidental Mutation 'R2864:Gm7168'
ID253124
Institutional Source Beutler Lab
Gene Symbol Gm7168
Ensembl Gene ENSMUSG00000067941
Gene Namepredicted gene 7168
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R2864 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location13948373-13950678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13949855 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 495 (K495E)
Ref Sequence ENSEMBL: ENSMUSP00000094997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088809]
Predicted Effect probably benign
Transcript: ENSMUST00000088809
AA Change: K495E

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000094997
Gene: ENSMUSG00000067941
AA Change: K495E

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
S_TKc 28 276 5.25e-91 SMART
UBA 296 333 4.39e-2 SMART
low complexity region 436 451 N/A INTRINSIC
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap30 G T 1: 171,408,206 G716V probably damaging Het
Crk T C 11: 75,703,385 V266A probably damaging Het
Dock4 T A 12: 40,730,073 F624L probably damaging Het
Fhod1 T C 8: 105,332,911 K714R probably null Het
Flt1 T C 5: 147,594,621 Q844R possibly damaging Het
Fn1 A G 1: 71,602,419 V1656A probably damaging Het
Fnip1 T C 11: 54,502,424 I562T probably damaging Het
Gm884 A G 11: 103,540,918 F1357S probably benign Het
Igf2r T C 17: 12,686,724 H2240R probably damaging Het
Itpr3 T C 17: 27,091,551 V436A probably benign Het
Lrp1b G T 2: 40,874,995 Q2826K possibly damaging Het
Luc7l C A 17: 26,266,361 Q112K probably damaging Het
Misp A G 10: 79,827,038 K430E probably benign Het
Olfr902 A G 9: 38,449,388 N172S possibly damaging Het
Oprm1 T A 10: 6,794,226 probably null Het
Paqr3 C T 5: 97,099,736 R171H possibly damaging Het
Phc3 C T 3: 30,914,128 D920N probably damaging Het
Pigk T C 3: 152,722,552 V72A probably damaging Het
Prickle1 C T 15: 93,509,278 G112R probably damaging Het
Rrbp1 T C 2: 143,957,637 E1050G probably damaging Het
Vmn2r93 A T 17: 18,326,061 I732F probably damaging Het
Xkr6 T C 14: 63,819,756 L372P unknown Het
Zfp523 T C 17: 28,202,540 V60A probably benign Het
Other mutations in Gm7168
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Gm7168 APN 17 13949858 missense probably benign 0.00
IGL01392:Gm7168 APN 17 13948907 missense probably benign
IGL01577:Gm7168 APN 17 13949387 missense probably damaging 0.99
IGL01691:Gm7168 APN 17 13948878 missense probably damaging 0.96
R0064:Gm7168 UTSW 17 13949859 missense probably benign 0.21
R0611:Gm7168 UTSW 17 13949535 missense probably benign
R0737:Gm7168 UTSW 17 13948983 missense probably damaging 1.00
R1789:Gm7168 UTSW 17 13949584 missense probably benign 0.03
R2865:Gm7168 UTSW 17 13949855 missense probably benign 0.42
R4179:Gm7168 UTSW 17 13949003 missense probably benign 0.00
R4652:Gm7168 UTSW 17 13949807 missense possibly damaging 0.88
R5174:Gm7168 UTSW 17 13948455 missense probably damaging 1.00
R5722:Gm7168 UTSW 17 13949562 missense probably benign
R6180:Gm7168 UTSW 17 13948596 missense probably damaging 0.98
R7195:Gm7168 UTSW 17 13949360 missense probably benign 0.01
R7366:Gm7168 UTSW 17 13949885 missense probably damaging 1.00
X0020:Gm7168 UTSW 17 13949736 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATACGTGCCATGAGTGTCCC -3'
(R):5'- GGGTTCAGCAAGACAACTGTG -3'

Sequencing Primer
(F):5'- ATGAGTGTCCCCTGCATGC -3'
(R):5'- ATTCATATTGAGACCCTGCTGG -3'
Posted On2014-12-04