Mutagenetix > Incidental Mutation

Incidental Mutation 'R2472:Nfasc'

253143

Institutional Source

Beutler Lab

Gene Symbol

Nfasc

Ensembl Gene

ENSMUSG00000026442

Gene Name

neurofascin

Synonyms

D430023G06Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2472 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

132492428-132669535 bp(-) (GRCm39)

Type of Mutation

intron

DNA Base Change (assembly)

T to A at 132515959 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043189] [ENSMUST00000094569] [ENSMUST00000163770] [ENSMUST00000187861]

AlphaFold

Q810U3

Predicted Effect

probably benign
Transcript: ENSMUST00000043189

SMART Domains

Protein: ENSMUSP00000035454
Gene: ENSMUSG00000026442

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	42	131	4.5e0	SMART
IG	141	228	2.44e-7	SMART
IGc2	253	317	1.53e-17	SMART
IGc2	343	409	1.76e-8	SMART
IGc2	437	502	2.39e-10	SMART
IGc2	528	593	2.54e-5	SMART
FN3	607	690	2.17e-11	SMART
FN3	707	789	2.85e-6	SMART
FN3	805	896	2.21e-3	SMART
FN3	911	995	9.92e-6	SMART
low complexity region	996	1018	N/A	INTRINSIC
transmembrane domain	1026	1048	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1049	1133	1.4e-29	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000094569
AA Change: T958S

SMART Domains

Protein: ENSMUSP00000092148
Gene: ENSMUSG00000026442
AA Change: T958S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	48	137	4.5e0	SMART
IG	147	234	2.44e-7	SMART
IGc2	259	323	1.53e-17	SMART
IGc2	349	415	1.76e-8	SMART
IGc2	443	508	2.39e-10	SMART
IGc2	534	599	2.54e-5	SMART
FN3	628	711	2.17e-11	SMART
FN3	728	810	2.85e-6	SMART
FN3	825	909	9.92e-6	SMART
FN3	1010	1086	6.91e-5	SMART
transmembrane domain	1109	1131	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1132	1216	2.2e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163770

SMART Domains

Protein: ENSMUSP00000132979
Gene: ENSMUSG00000026442

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	42	131	4.5e0	SMART
IG	141	228	2.44e-7	SMART
IGc2	270	334	1.53e-17	SMART
IGc2	360	426	1.76e-8	SMART
IGc2	454	519	2.39e-10	SMART
IGc2	545	610	2.54e-5	SMART
FN3	624	707	2.17e-11	SMART
FN3	724	806	2.85e-6	SMART
FN3	822	913	2.21e-3	SMART
FN3	928	1012	9.92e-6	SMART
low complexity region	1013	1035	N/A	INTRINSIC
transmembrane domain	1043	1065	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1066	1150	5e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186330

Predicted Effect

probably benign
Transcript: ENSMUST00000186389

Predicted Effect

unknown
Transcript: ENSMUST00000187861
AA Change: T1065S

SMART Domains

Protein: ENSMUSP00000139955
Gene: ENSMUSG00000026442
AA Change: T1065S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	48	137	1.8e-2	SMART
IG	147	234	1e-9	SMART
IGc2	259	323	6.4e-20	SMART
IGc2	349	415	7e-11	SMART
IGc2	443	508	9.7e-13	SMART
IGc2	534	599	1.1e-7	SMART
FN3	628	711	1e-13	SMART
FN3	728	810	1.4e-8	SMART
FN3	826	917	1.1e-5	SMART
FN3	932	1016	4.8e-8	SMART
FN3	1117	1193	3.4e-7	SMART
transmembrane domain	1216	1238	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1239	1325	2.6e-26	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes an L1 family immunoglobulin cell adhesion molecule with multiple IGcam and fibronectin domains. The protein functions in neurite outgrowth, neurite fasciculation, and organization of the axon initial segment (AIS) and nodes of Ranvier on axons during early development. Both the AIS and nodes of Ranvier contain high densities of voltage-gated Na+ (Nav) channels which are clustered by interactions with cytoskeletal and scaffolding proteins including this protein, gliomedin, ankyrin 3 (ankyrin-G), and betaIV spectrin. This protein links the AIS extracellular matrix to the intracellular cytoskeleton. This gene undergoes extensive alternative splicing, and the full-length nature of some variants has not been determined. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele die within 6 to 7 days of birth, exhibit reduced nerve conduction velocity and abnormal paranodal junction formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aacs	T	C	5: 125,583,316 (GRCm39)	S291P	probably damaging	Het
Cbln3	T	C	14: 56,121,538 (GRCm39)	E36G	possibly damaging	Het
Cdcp1	A	G	9: 123,014,172 (GRCm39)	F201L	probably benign	Het
Crispld1	A	T	1: 17,816,052 (GRCm39)	R142S	probably null	Het
Dsc2	T	A	18: 20,178,526 (GRCm39)	M293L	probably benign	Het
Dzip3	A	T	16: 48,774,150 (GRCm39)	S362T	possibly damaging	Het
Grm4	C	T	17: 27,653,649 (GRCm39)	C512Y	probably damaging	Het
Klk14	G	A	7: 43,341,501 (GRCm39)	C51Y	probably damaging	Het
L1td1	C	T	4: 98,621,396 (GRCm39)		probably benign	Het
Nav2	A	G	7: 49,058,632 (GRCm39)	T252A	probably benign	Het
Neu3	A	C	7: 99,462,614 (GRCm39)	S370A	probably damaging	Het
Or2o1	T	C	11: 49,051,198 (GRCm39)	V119A	possibly damaging	Het
Ptk7	T	C	17: 46,887,774 (GRCm39)	T553A	probably benign	Het
Rap2a	T	C	14: 120,716,245 (GRCm39)	I36T	possibly damaging	Het
Rinl	A	C	7: 28,489,803 (GRCm39)	D7A	possibly damaging	Het
Rufy4	T	C	1: 74,186,822 (GRCm39)	C537R	probably damaging	Het
Sec16a	T	C	2: 26,329,948 (GRCm39)	E689G	probably damaging	Het
Sec31a	T	C	5: 100,533,064 (GRCm39)	I560M	probably damaging	Het
Secisbp2l	C	T	2: 125,582,657 (GRCm39)	G933D	possibly damaging	Het
Setdb2	G	A	14: 59,656,903 (GRCm39)	T138I	possibly damaging	Het
Sgsh	G	T	11: 119,246,300 (GRCm39)	P4Q	possibly damaging	Het
Slco4a1	G	T	2: 180,108,880 (GRCm39)	W308L	probably damaging	Het
Ttn	T	A	2: 76,611,863 (GRCm39)	R17346S	possibly damaging	Het
Ubxn4	A	G	1: 128,200,606 (GRCm39)	R366G	probably damaging	Het
Vmn2r90	T	G	17: 17,948,408 (GRCm39)	N551K	probably damaging	Het

Other mutations in Nfasc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00895:Nfasc	APN	1	132,501,536 (GRCm39)	nonsense	probably null
IGL01088:Nfasc	APN	1	132,570,514 (GRCm39)	utr 5 prime	probably benign
IGL01958:Nfasc	APN	1	132,536,176 (GRCm39)	nonsense	probably null
IGL01999:Nfasc	APN	1	132,532,985 (GRCm39)	splice site	probably benign
IGL02170:Nfasc	APN	1	132,538,104 (GRCm39)	nonsense	probably null
IGL02187:Nfasc	APN	1	132,498,219 (GRCm39)	missense	probably damaging	1.00
IGL02192:Nfasc	APN	1	132,498,219 (GRCm39)	missense	probably damaging	1.00
IGL02452:Nfasc	APN	1	132,548,662 (GRCm39)	critical splice donor site	probably null
IGL02698:Nfasc	APN	1	132,562,475 (GRCm39)	missense	probably benign	0.06
IGL02797:Nfasc	APN	1	132,538,186 (GRCm39)	missense	probably damaging	1.00
IGL03000:Nfasc	APN	1	132,549,247 (GRCm39)	splice site	probably benign
IGL03027:Nfasc	APN	1	132,538,207 (GRCm39)	missense	probably damaging	1.00
Fascist	UTSW	1	132,539,343 (GRCm39)	missense	probably damaging	1.00
jiggle	UTSW	1	132,529,759 (GRCm39)	missense	probably damaging	1.00
Partisan	UTSW	1	132,533,287 (GRCm39)	missense	probably damaging	1.00
Tremble	UTSW	1	132,539,333 (GRCm39)	missense	probably damaging	1.00
PIT4377001:Nfasc	UTSW	1	132,510,804 (GRCm39)	missense	unknown
R0240:Nfasc	UTSW	1	132,529,721 (GRCm39)	missense	probably damaging	1.00
R0240:Nfasc	UTSW	1	132,529,721 (GRCm39)	missense	probably damaging	1.00
R0241:Nfasc	UTSW	1	132,564,731 (GRCm39)	missense	probably benign	0.02
R0241:Nfasc	UTSW	1	132,564,731 (GRCm39)	missense	probably benign	0.02
R0418:Nfasc	UTSW	1	132,539,333 (GRCm39)	missense	probably damaging	1.00
R0513:Nfasc	UTSW	1	132,531,584 (GRCm39)	missense	possibly damaging	0.95
R0639:Nfasc	UTSW	1	132,531,554 (GRCm39)	missense	probably damaging	1.00
R0646:Nfasc	UTSW	1	132,536,176 (GRCm39)	nonsense	probably null
R1103:Nfasc	UTSW	1	132,534,795 (GRCm39)	splice site	probably benign
R1269:Nfasc	UTSW	1	132,538,526 (GRCm39)	missense	probably damaging	1.00
R1550:Nfasc	UTSW	1	132,536,241 (GRCm39)	missense	probably damaging	0.96
R1749:Nfasc	UTSW	1	132,539,370 (GRCm39)	missense	probably damaging	1.00
R1773:Nfasc	UTSW	1	132,538,577 (GRCm39)	missense	probably damaging	1.00
R1921:Nfasc	UTSW	1	132,538,543 (GRCm39)	missense	probably damaging	1.00
R1987:Nfasc	UTSW	1	132,538,624 (GRCm39)	missense	probably damaging	1.00
R2141:Nfasc	UTSW	1	132,524,383 (GRCm39)	missense	probably damaging	1.00
R2239:Nfasc	UTSW	1	132,510,760 (GRCm39)	intron	probably benign
R2413:Nfasc	UTSW	1	132,523,243 (GRCm39)	missense	probably damaging	1.00
R2428:Nfasc	UTSW	1	132,523,392 (GRCm39)	missense	possibly damaging	0.55
R2517:Nfasc	UTSW	1	132,525,501 (GRCm39)	splice site	probably null
R3850:Nfasc	UTSW	1	132,559,471 (GRCm39)	missense	probably damaging	1.00
R4050:Nfasc	UTSW	1	132,538,043 (GRCm39)	splice site	probably benign
R4061:Nfasc	UTSW	1	132,525,583 (GRCm39)	missense	probably damaging	1.00
R4088:Nfasc	UTSW	1	132,523,329 (GRCm39)	missense	probably damaging	1.00
R4342:Nfasc	UTSW	1	132,559,443 (GRCm39)	missense	probably damaging	1.00
R4343:Nfasc	UTSW	1	132,559,443 (GRCm39)	missense	probably damaging	1.00
R4345:Nfasc	UTSW	1	132,559,443 (GRCm39)	missense	probably damaging	1.00
R4452:Nfasc	UTSW	1	132,562,409 (GRCm39)	missense	probably damaging	1.00
R4818:Nfasc	UTSW	1	132,531,568 (GRCm39)	missense	possibly damaging	0.87
R4851:Nfasc	UTSW	1	132,529,759 (GRCm39)	missense	probably damaging	1.00
R5014:Nfasc	UTSW	1	132,512,185 (GRCm39)	intron	probably benign
R5768:Nfasc	UTSW	1	132,532,883 (GRCm39)	missense	probably benign	0.00
R6145:Nfasc	UTSW	1	132,562,455 (GRCm39)	missense	probably damaging	1.00
R6335:Nfasc	UTSW	1	132,504,132 (GRCm39)	missense	probably damaging	0.98
R6379:Nfasc	UTSW	1	132,498,280 (GRCm39)	nonsense	probably null
R6486:Nfasc	UTSW	1	132,532,952 (GRCm39)	missense	probably damaging	1.00
R7022:Nfasc	UTSW	1	132,548,787 (GRCm39)	missense	probably damaging	1.00
R7062:Nfasc	UTSW	1	132,529,707 (GRCm39)	critical splice donor site	probably null
R7084:Nfasc	UTSW	1	132,498,247 (GRCm39)	missense	unknown
R7275:Nfasc	UTSW	1	132,562,001 (GRCm39)	missense	probably damaging	1.00
R7286:Nfasc	UTSW	1	132,529,790 (GRCm39)	missense	probably damaging	1.00
R7682:Nfasc	UTSW	1	132,501,511 (GRCm39)	missense	unknown
R7838:Nfasc	UTSW	1	132,533,287 (GRCm39)	missense	probably damaging	1.00
R7871:Nfasc	UTSW	1	132,527,751 (GRCm39)	missense	not run
R7938:Nfasc	UTSW	1	132,533,269 (GRCm39)	missense	probably damaging	1.00
R8083:Nfasc	UTSW	1	132,524,320 (GRCm39)	missense	probably benign	0.00
R8482:Nfasc	UTSW	1	132,532,827 (GRCm39)	missense	probably damaging	1.00
R9027:Nfasc	UTSW	1	132,539,343 (GRCm39)	missense	probably damaging	1.00
R9164:Nfasc	UTSW	1	132,562,544 (GRCm39)	missense	probably damaging	1.00
R9488:Nfasc	UTSW	1	132,527,866 (GRCm39)	missense	possibly damaging	0.68
R9651:Nfasc	UTSW	1	132,527,791 (GRCm39)	missense	probably benign	0.04
Z1176:Nfasc	UTSW	1	132,562,376 (GRCm39)	missense	probably benign	0.00
Z1177:Nfasc	UTSW	1	132,559,576 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTAATTGCCACTCCAAAGCC -3'
(R):5'- GACTTCTGAGCCCATCTCAC -3'

Sequencing Primer
(F):5'- CATTGCTCAGCCAGGGAAATCTG -3'
(R):5'- TGAGCCCATCTCACCACTGG -3'

Posted On

2014-12-04