Incidental Mutation 'R2472:Sec31a'
ID 253153
Institutional Source Beutler Lab
Gene Symbol Sec31a
Ensembl Gene ENSMUSG00000035325
Gene Name SEC31 homolog A, COPII coat complex component
Synonyms 1810024J13Rik, Sec31l1
Accession Numbers
Essential gene? Probably essential (E-score: 0.899) question?
Stock # R2472 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 100509508-100564093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100533064 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 560 (I560M)
Ref Sequence ENSEMBL: ENSMUSP00000138213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094578] [ENSMUST00000182886] [ENSMUST00000183247]
AlphaFold Q3UPL0
Predicted Effect probably damaging
Transcript: ENSMUST00000094578
AA Change: I599M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092157
Gene: ENSMUSG00000035325
AA Change: I599M

DomainStartEndE-ValueType
WD40 56 102 1.59e1 SMART
WD40 111 151 5.15e-2 SMART
WD40 158 197 5.16e-1 SMART
WD40 200 245 6.63e0 SMART
WD40 249 289 1.95e-2 SMART
WD40 292 332 4.24e-3 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 572 769 3.5e-7 PFAM
low complexity region 866 882 N/A INTRINSIC
low complexity region 930 949 N/A INTRINSIC
low complexity region 953 975 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182812
Predicted Effect probably damaging
Transcript: ENSMUST00000182886
AA Change: I560M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138213
Gene: ENSMUSG00000035325
AA Change: I560M

DomainStartEndE-ValueType
WD40 56 102 1e-1 SMART
WD40 111 151 3.3e-4 SMART
WD40 158 197 3.2e-3 SMART
WD40 200 245 4.1e-2 SMART
WD40 249 289 1.2e-4 SMART
WD40 292 332 2.6e-5 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 532 731 2.1e-6 PFAM
low complexity region 827 843 N/A INTRINSIC
low complexity region 891 910 N/A INTRINSIC
low complexity region 914 936 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182988
AA Change: I299M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000183247
AA Change: I169M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138129
Gene: ENSMUSG00000035325
AA Change: I169M

DomainStartEndE-ValueType
Pfam:Sec16_C 141 248 1.5e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(31) : Gene trapped(31)

Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T C 5: 125,583,316 (GRCm39) S291P probably damaging Het
Cbln3 T C 14: 56,121,538 (GRCm39) E36G possibly damaging Het
Cdcp1 A G 9: 123,014,172 (GRCm39) F201L probably benign Het
Crispld1 A T 1: 17,816,052 (GRCm39) R142S probably null Het
Dsc2 T A 18: 20,178,526 (GRCm39) M293L probably benign Het
Dzip3 A T 16: 48,774,150 (GRCm39) S362T possibly damaging Het
Grm4 C T 17: 27,653,649 (GRCm39) C512Y probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
L1td1 C T 4: 98,621,396 (GRCm39) probably benign Het
Nav2 A G 7: 49,058,632 (GRCm39) T252A probably benign Het
Neu3 A C 7: 99,462,614 (GRCm39) S370A probably damaging Het
Nfasc T A 1: 132,515,959 (GRCm39) probably benign Het
Or2o1 T C 11: 49,051,198 (GRCm39) V119A possibly damaging Het
Ptk7 T C 17: 46,887,774 (GRCm39) T553A probably benign Het
Rap2a T C 14: 120,716,245 (GRCm39) I36T possibly damaging Het
Rinl A C 7: 28,489,803 (GRCm39) D7A possibly damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Sec16a T C 2: 26,329,948 (GRCm39) E689G probably damaging Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Setdb2 G A 14: 59,656,903 (GRCm39) T138I possibly damaging Het
Sgsh G T 11: 119,246,300 (GRCm39) P4Q possibly damaging Het
Slco4a1 G T 2: 180,108,880 (GRCm39) W308L probably damaging Het
Ttn T A 2: 76,611,863 (GRCm39) R17346S possibly damaging Het
Ubxn4 A G 1: 128,200,606 (GRCm39) R366G probably damaging Het
Vmn2r90 T G 17: 17,948,408 (GRCm39) N551K probably damaging Het
Other mutations in Sec31a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Sec31a APN 5 100,551,876 (GRCm39) nonsense probably null
IGL01610:Sec31a APN 5 100,550,217 (GRCm39) splice site probably benign
IGL01804:Sec31a APN 5 100,523,065 (GRCm39) critical splice donor site probably null
IGL02026:Sec31a APN 5 100,517,485 (GRCm39) missense probably benign 0.04
IGL02150:Sec31a APN 5 100,533,984 (GRCm39) splice site probably benign
IGL02237:Sec31a APN 5 100,509,914 (GRCm39) missense probably damaging 1.00
IGL02469:Sec31a APN 5 100,533,114 (GRCm39) missense probably benign 0.02
IGL02512:Sec31a APN 5 100,555,052 (GRCm39) missense probably damaging 0.99
control UTSW 5 100,510,032 (GRCm39) missense probably damaging 1.00
D3080:Sec31a UTSW 5 100,511,691 (GRCm39) missense probably damaging 1.00
PIT4142001:Sec31a UTSW 5 100,555,134 (GRCm39) missense probably damaging 1.00
R0366:Sec31a UTSW 5 100,530,625 (GRCm39) missense probably damaging 1.00
R0453:Sec31a UTSW 5 100,551,977 (GRCm39) splice site probably benign
R0511:Sec31a UTSW 5 100,523,099 (GRCm39) missense probably benign 0.01
R0546:Sec31a UTSW 5 100,551,929 (GRCm39) missense probably damaging 1.00
R0675:Sec31a UTSW 5 100,541,066 (GRCm39) missense probably damaging 0.97
R0678:Sec31a UTSW 5 100,555,084 (GRCm39) missense possibly damaging 0.74
R0975:Sec31a UTSW 5 100,543,763 (GRCm39) splice site probably null
R1146:Sec31a UTSW 5 100,510,032 (GRCm39) missense probably damaging 1.00
R1146:Sec31a UTSW 5 100,510,032 (GRCm39) missense probably damaging 1.00
R1540:Sec31a UTSW 5 100,523,178 (GRCm39) missense probably damaging 1.00
R1616:Sec31a UTSW 5 100,534,054 (GRCm39) missense possibly damaging 0.88
R1780:Sec31a UTSW 5 100,529,195 (GRCm39) splice site probably null
R3689:Sec31a UTSW 5 100,530,766 (GRCm39) missense probably damaging 1.00
R4515:Sec31a UTSW 5 100,513,817 (GRCm39) missense probably damaging 0.99
R4801:Sec31a UTSW 5 100,541,222 (GRCm39) missense probably damaging 0.96
R4802:Sec31a UTSW 5 100,541,222 (GRCm39) missense probably damaging 0.96
R4896:Sec31a UTSW 5 100,516,192 (GRCm39) missense probably damaging 1.00
R5004:Sec31a UTSW 5 100,516,192 (GRCm39) missense probably damaging 1.00
R5053:Sec31a UTSW 5 100,541,073 (GRCm39) missense possibly damaging 0.94
R5158:Sec31a UTSW 5 100,541,180 (GRCm39) missense probably damaging 0.99
R5191:Sec31a UTSW 5 100,553,370 (GRCm39) missense possibly damaging 0.75
R5222:Sec31a UTSW 5 100,530,754 (GRCm39) missense probably benign
R5405:Sec31a UTSW 5 100,531,657 (GRCm39) nonsense probably null
R5436:Sec31a UTSW 5 100,511,698 (GRCm39) missense probably damaging 0.98
R5577:Sec31a UTSW 5 100,550,133 (GRCm39) missense possibly damaging 0.95
R6005:Sec31a UTSW 5 100,511,737 (GRCm39) missense probably damaging 1.00
R6184:Sec31a UTSW 5 100,517,453 (GRCm39) critical splice donor site probably null
R6245:Sec31a UTSW 5 100,534,043 (GRCm39) missense probably benign 0.07
R6475:Sec31a UTSW 5 100,533,129 (GRCm39) missense probably damaging 1.00
R6476:Sec31a UTSW 5 100,534,008 (GRCm39) missense probably benign 0.03
R6744:Sec31a UTSW 5 100,540,358 (GRCm39) missense possibly damaging 0.47
R6804:Sec31a UTSW 5 100,530,671 (GRCm39) missense probably benign 0.03
R6911:Sec31a UTSW 5 100,541,123 (GRCm39) missense possibly damaging 0.92
R6936:Sec31a UTSW 5 100,540,369 (GRCm39) missense probably benign
R7345:Sec31a UTSW 5 100,533,129 (GRCm39) missense probably damaging 1.00
R7760:Sec31a UTSW 5 100,540,487 (GRCm39) missense probably damaging 1.00
R7898:Sec31a UTSW 5 100,547,336 (GRCm39) missense probably damaging 0.99
R8088:Sec31a UTSW 5 100,526,721 (GRCm39) missense
R8555:Sec31a UTSW 5 100,540,273 (GRCm39) missense probably benign 0.25
R8762:Sec31a UTSW 5 100,526,688 (GRCm39) missense
R9055:Sec31a UTSW 5 100,534,040 (GRCm39) missense possibly damaging 0.75
R9173:Sec31a UTSW 5 100,529,147 (GRCm39) missense possibly damaging 0.85
R9249:Sec31a UTSW 5 100,533,083 (GRCm39) missense probably damaging 0.98
X0003:Sec31a UTSW 5 100,547,213 (GRCm39) missense probably damaging 0.98
Z1177:Sec31a UTSW 5 100,531,704 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGGAATTGTTTCACATCAAAAC -3'
(R):5'- TCCACTTGTCTGTGAATGAAATC -3'

Sequencing Primer
(F):5'- CCTCCCGAGTGCTAGGATTAAAG -3'
(R):5'- ACGGTCTAATTACCCGG -3'
Posted On 2014-12-04