Incidental Mutation 'R2865:Fhod1'
ID253164
Institutional Source Beutler Lab
Gene Symbol Fhod1
Ensembl Gene ENSMUSG00000014778
Gene Nameformin homology 2 domain containing 1
Synonyms
MMRRC Submission 040454-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R2865 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105329163-105347953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105332911 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 714 (K714R)
Ref Sequence ENSEMBL: ENSMUSP00000014922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014922] [ENSMUST00000015000] [ENSMUST00000098453] [ENSMUST00000109372] [ENSMUST00000126705] [ENSMUST00000153146]
Predicted Effect probably null
Transcript: ENSMUST00000014922
AA Change: K714R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000014922
Gene: ENSMUSG00000014778
AA Change: K714R

DomainStartEndE-ValueType
PDB:3DAD|B 1 339 N/A PDB
Blast:Drf_GBD 85 216 1e-48 BLAST
SCOP:d1ee4a_ 120 240 4e-4 SMART
Blast:FH2 231 318 6e-38 BLAST
low complexity region 342 357 N/A INTRINSIC
Blast:FH2 386 483 2e-10 BLAST
low complexity region 514 532 N/A INTRINSIC
low complexity region 573 643 N/A INTRINSIC
FH2 648 1100 3.16e-121 SMART
low complexity region 1119 1130 N/A INTRINSIC
Blast:FH2 1135 1179 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000015000
SMART Domains Protein: ENSMUSP00000015000
Gene: ENSMUSG00000014856

DomainStartEndE-ValueType
Pfam:DUF788 7 171 1.1e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098453
SMART Domains Protein: ENSMUSP00000096052
Gene: ENSMUSG00000014856

DomainStartEndE-ValueType
Pfam:DUF788 7 103 3.7e-29 PFAM
low complexity region 118 133 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109372
SMART Domains Protein: ENSMUSP00000104997
Gene: ENSMUSG00000014856

DomainStartEndE-ValueType
Pfam:DUF788 7 103 4.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126705
SMART Domains Protein: ENSMUSP00000138226
Gene: ENSMUSG00000014856

DomainStartEndE-ValueType
Pfam:DUF788 7 100 3e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136439
Predicted Effect probably benign
Transcript: ENSMUST00000153146
SMART Domains Protein: ENSMUSP00000138470
Gene: ENSMUSG00000014856

DomainStartEndE-ValueType
Pfam:DUF788 7 100 3e-29 PFAM
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik A G 8: 12,279,635 Q30R unknown Het
Bmper A G 9: 23,483,941 N656S probably benign Het
Cic T A 7: 25,273,221 D792E probably damaging Het
Dab1 G A 4: 104,680,146 C192Y probably benign Het
Ddx6 G T 9: 44,614,256 L103F probably damaging Het
Flt1 T C 5: 147,594,621 Q844R possibly damaging Het
Fnip1 T C 11: 54,502,424 I562T probably damaging Het
Fxr2 T A 11: 69,639,427 I40N probably damaging Het
Gm5065 G T 7: 5,359,669 D100Y probably benign Het
Gm7168 A G 17: 13,949,855 K495E probably benign Het
Gria2 C T 3: 80,732,085 V207I probably benign Het
Ifna6 G C 4: 88,827,862 R149S probably benign Het
Ifna6 C A 4: 88,827,849 T145K probably benign Het
Igf2r T C 17: 12,686,724 H2240R probably damaging Het
Ighv8-9 G A 12: 115,468,446 P82S probably benign Het
Itpr3 T C 17: 27,091,551 V436A probably benign Het
Ldb3 T G 14: 34,529,503 D609A probably damaging Het
Luc7l C A 17: 26,266,361 Q112K probably damaging Het
March4 C T 1: 72,452,575 R179H probably damaging Het
Myt1l A G 12: 29,910,789 T75A probably benign Het
Olfr1094 A T 2: 86,828,854 D34V probably benign Het
Olfr1100 A T 2: 86,978,461 C112S possibly damaging Het
Parp4 C T 14: 56,613,724 T728M probably damaging Het
Ppp1r10 A G 17: 35,928,492 T398A possibly damaging Het
Ppp4c A T 7: 126,792,100 I20N probably damaging Het
Rph3a C T 5: 120,947,927 G482D probably damaging Het
Rtel1 T A 2: 181,349,972 F388I probably benign Het
Slc12a6 G A 2: 112,347,317 V594I probably benign Het
Slc2a4 G A 11: 69,946,116 S134F probably damaging Het
Tead4 A T 6: 128,248,099 probably null Het
Usp40 G A 1: 87,949,979 Q1152* probably null Het
Other mutations in Fhod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Fhod1 APN 8 105332102 missense possibly damaging 0.66
IGL01149:Fhod1 APN 8 105347807 unclassified probably benign
IGL01325:Fhod1 APN 8 105331649 missense probably benign 0.33
IGL01470:Fhod1 APN 8 105329649 missense probably damaging 1.00
IGL01521:Fhod1 APN 8 105330423 missense probably benign 0.17
IGL01861:Fhod1 APN 8 105331176 missense probably damaging 1.00
IGL02864:Fhod1 APN 8 105337164 unclassified probably benign
IGL02951:Fhod1 APN 8 105331230 missense probably damaging 1.00
reactive UTSW 8 105336434 unclassified probably benign
treason UTSW 8 105337350 unclassified probably benign
R0016:Fhod1 UTSW 8 105331655 missense possibly damaging 0.91
R0016:Fhod1 UTSW 8 105331655 missense possibly damaging 0.91
R0071:Fhod1 UTSW 8 105337225 splice site probably null
R0071:Fhod1 UTSW 8 105337225 splice site probably null
R0498:Fhod1 UTSW 8 105329856 missense probably damaging 1.00
R1234:Fhod1 UTSW 8 105337163 unclassified probably benign
R1465:Fhod1 UTSW 8 105338914 unclassified probably benign
R1465:Fhod1 UTSW 8 105338914 unclassified probably benign
R1485:Fhod1 UTSW 8 105336798 critical splice acceptor site probably null
R1585:Fhod1 UTSW 8 105337325 unclassified probably benign
R1615:Fhod1 UTSW 8 105347831 unclassified probably benign
R1778:Fhod1 UTSW 8 105329677 missense probably damaging 1.00
R1781:Fhod1 UTSW 8 105347789 unclassified probably benign
R2291:Fhod1 UTSW 8 105336964 unclassified probably benign
R2864:Fhod1 UTSW 8 105332911 missense probably null 0.97
R3775:Fhod1 UTSW 8 105331638 unclassified probably benign
R4107:Fhod1 UTSW 8 105338038 unclassified probably benign
R4422:Fhod1 UTSW 8 105337351 unclassified probably benign
R4423:Fhod1 UTSW 8 105337351 unclassified probably benign
R4424:Fhod1 UTSW 8 105337351 unclassified probably benign
R4425:Fhod1 UTSW 8 105337351 unclassified probably benign
R4641:Fhod1 UTSW 8 105329592 missense probably damaging 1.00
R4724:Fhod1 UTSW 8 105337861 unclassified probably benign
R4757:Fhod1 UTSW 8 105347811 unclassified probably benign
R5004:Fhod1 UTSW 8 105336945 unclassified probably benign
R5082:Fhod1 UTSW 8 105330513 missense probably damaging 1.00
R6033:Fhod1 UTSW 8 105336434 unclassified probably benign
R6033:Fhod1 UTSW 8 105336434 unclassified probably benign
R6298:Fhod1 UTSW 8 105337148 unclassified probably benign
R6320:Fhod1 UTSW 8 105337350 unclassified probably benign
R6362:Fhod1 UTSW 8 105331641 critical splice donor site probably null
R6449:Fhod1 UTSW 8 105330237 missense probably damaging 1.00
R6736:Fhod1 UTSW 8 105337890 unclassified probably benign
R6816:Fhod1 UTSW 8 105330544 missense probably benign 0.10
R6955:Fhod1 UTSW 8 105333007 missense probably benign 0.00
R7073:Fhod1 UTSW 8 105337139 missense unknown
R7567:Fhod1 UTSW 8 105347837 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTAATGAACCCATGACTGGAG -3'
(R):5'- TTTACCCACTCAGCACTTGACG -3'

Sequencing Primer
(F):5'- CCCATGACTGGAGATAAGAGATACAC -3'
(R):5'- AGCACTTGACGGCCCAAG -3'
Posted On2014-12-04