Incidental Mutation 'R2472:Sgsh'
ID 253175
Institutional Source Beutler Lab
Gene Symbol Sgsh
Ensembl Gene ENSMUSG00000005043
Gene Name N-sulfoglucosamine sulfohydrolase (sulfamidase)
Synonyms sulphamidase, 4632406A19Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R2472 (G1)
Quality Score 143
Status Not validated
Chromosome 11
Chromosomal Location 119234315-119246336 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 119246300 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 4 (P4Q)
Ref Sequence ENSEMBL: ENSMUSP00000097748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005173] [ENSMUST00000050880] [ENSMUST00000100172] [ENSMUST00000136523]
AlphaFold Q9EQ08
Predicted Effect probably benign
Transcript: ENSMUST00000005173
AA Change: P4Q

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000005173
Gene: ENSMUSG00000005043
AA Change: P4Q

DomainStartEndE-ValueType
Pfam:Sulfatase 23 328 2.6e-60 PFAM
Pfam:Phosphodiest 25 287 5.2e-8 PFAM
low complexity region 348 357 N/A INTRINSIC
Pfam:DUF4976 400 477 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050880
SMART Domains Protein: ENSMUSP00000050999
Gene: ENSMUSG00000039908

DomainStartEndE-ValueType
Pfam:Sulfate_transp 31 424 1.8e-97 PFAM
transmembrane domain 426 448 N/A INTRINSIC
Pfam:STAS 453 559 3.6e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100172
AA Change: P4Q

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097748
Gene: ENSMUSG00000005043
AA Change: P4Q

DomainStartEndE-ValueType
Pfam:Sulfatase 23 250 1.7e-35 PFAM
Pfam:Phosphodiest 25 237 2.7e-8 PFAM
low complexity region 311 329 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133507
Predicted Effect unknown
Transcript: ENSMUST00000136523
AA Change: P4Q
SMART Domains Protein: ENSMUSP00000115587
Gene: ENSMUSG00000005043
AA Change: P4Q

DomainStartEndE-ValueType
PDB:4MIV|H 1 30 1e-5 PDB
low complexity region 40 56 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147366
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several enzymes involved in the lysosomal degradation of heparan sulfate. Mutations in this gene are associated with Sanfilippo syndrome A, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. Transcripts of varying sizes have been reported but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele die prematurely displaying low sulfamidase activity, variable lysosomal storage in various brain cell types and other tissues, heparan sulfate-uria, scruffy coats, corneal opacities, bladder distension, hydronephrosis, hepatosplenomegaly and bone deformities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T C 5: 125,583,316 (GRCm39) S291P probably damaging Het
Cbln3 T C 14: 56,121,538 (GRCm39) E36G possibly damaging Het
Cdcp1 A G 9: 123,014,172 (GRCm39) F201L probably benign Het
Crispld1 A T 1: 17,816,052 (GRCm39) R142S probably null Het
Dsc2 T A 18: 20,178,526 (GRCm39) M293L probably benign Het
Dzip3 A T 16: 48,774,150 (GRCm39) S362T possibly damaging Het
Grm4 C T 17: 27,653,649 (GRCm39) C512Y probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
L1td1 C T 4: 98,621,396 (GRCm39) probably benign Het
Nav2 A G 7: 49,058,632 (GRCm39) T252A probably benign Het
Neu3 A C 7: 99,462,614 (GRCm39) S370A probably damaging Het
Nfasc T A 1: 132,515,959 (GRCm39) probably benign Het
Or2o1 T C 11: 49,051,198 (GRCm39) V119A possibly damaging Het
Ptk7 T C 17: 46,887,774 (GRCm39) T553A probably benign Het
Rap2a T C 14: 120,716,245 (GRCm39) I36T possibly damaging Het
Rinl A C 7: 28,489,803 (GRCm39) D7A possibly damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Sec16a T C 2: 26,329,948 (GRCm39) E689G probably damaging Het
Sec31a T C 5: 100,533,064 (GRCm39) I560M probably damaging Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Setdb2 G A 14: 59,656,903 (GRCm39) T138I possibly damaging Het
Slco4a1 G T 2: 180,108,880 (GRCm39) W308L probably damaging Het
Ttn T A 2: 76,611,863 (GRCm39) R17346S possibly damaging Het
Ubxn4 A G 1: 128,200,606 (GRCm39) R366G probably damaging Het
Vmn2r90 T G 17: 17,948,408 (GRCm39) N551K probably damaging Het
Other mutations in Sgsh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Sgsh APN 11 119,237,311 (GRCm39) missense probably benign
IGL01549:Sgsh APN 11 119,241,755 (GRCm39) missense probably damaging 0.99
IGL02110:Sgsh APN 11 119,243,632 (GRCm39) missense probably damaging 1.00
IGL02878:Sgsh APN 11 119,237,384 (GRCm39) missense probably damaging 1.00
hindenburg UTSW 11 119,241,773 (GRCm39) missense probably damaging 1.00
ludendorff UTSW 11 119,237,183 (GRCm39) missense probably damaging 1.00
BB005:Sgsh UTSW 11 119,238,561 (GRCm39) missense probably benign 0.03
BB015:Sgsh UTSW 11 119,238,561 (GRCm39) missense probably benign 0.03
R1187:Sgsh UTSW 11 119,237,404 (GRCm39) nonsense probably null
R2342:Sgsh UTSW 11 119,238,540 (GRCm39) missense probably benign 0.01
R2571:Sgsh UTSW 11 119,241,340 (GRCm39) missense probably damaging 1.00
R3872:Sgsh UTSW 11 119,241,773 (GRCm39) missense probably damaging 1.00
R3873:Sgsh UTSW 11 119,241,773 (GRCm39) missense probably damaging 1.00
R3874:Sgsh UTSW 11 119,241,773 (GRCm39) missense probably damaging 1.00
R3875:Sgsh UTSW 11 119,241,773 (GRCm39) missense probably damaging 1.00
R5075:Sgsh UTSW 11 119,237,594 (GRCm39) missense probably benign 0.34
R5660:Sgsh UTSW 11 119,241,807 (GRCm39) missense probably damaging 1.00
R5938:Sgsh UTSW 11 119,237,625 (GRCm39) missense probably benign 0.08
R7302:Sgsh UTSW 11 119,238,525 (GRCm39) missense probably benign 0.02
R7484:Sgsh UTSW 11 119,237,183 (GRCm39) missense probably damaging 1.00
R7533:Sgsh UTSW 11 119,238,696 (GRCm39) missense probably damaging 1.00
R7552:Sgsh UTSW 11 119,237,378 (GRCm39) missense probably damaging 1.00
R7928:Sgsh UTSW 11 119,238,561 (GRCm39) missense probably benign 0.03
R7958:Sgsh UTSW 11 119,243,599 (GRCm39) missense probably damaging 0.98
R8013:Sgsh UTSW 11 119,243,521 (GRCm39) missense probably damaging 0.97
R8014:Sgsh UTSW 11 119,243,521 (GRCm39) missense probably damaging 0.97
R8912:Sgsh UTSW 11 119,243,486 (GRCm39) missense probably damaging 1.00
R9504:Sgsh UTSW 11 119,237,375 (GRCm39) missense probably benign 0.23
R9584:Sgsh UTSW 11 119,241,789 (GRCm39) missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- AGGGCCAGACGCATTTAGAG -3'
(R):5'- CGGACTCTAATGGTTTGCGG -3'

Sequencing Primer
(F):5'- ACGCATTTAGAGTCACCAGG -3'
(R):5'- ACAGCTCCTGGTGACCC -3'
Posted On 2014-12-04