Incidental Mutation 'R2865:Ppp1r10'
ID253196
Institutional Source Beutler Lab
Gene Symbol Ppp1r10
Ensembl Gene ENSMUSG00000039220
Gene Nameprotein phosphatase 1, regulatory subunit 10
SynonymsPNUTS, D17Ertd808e, 2610025H06Rik
MMRRC Submission 040454-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2865 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35916434-35932283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35928492 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 398 (T398A)
Ref Sequence ENSEMBL: ENSMUSP00000084461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087210] [ENSMUST00000087211] [ENSMUST00000151664]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087210
AA Change: T398A

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084460
Gene: ENSMUSG00000039220
AA Change: T398A

DomainStartEndE-ValueType
TFS2N 74 146 2.23e-22 SMART
low complexity region 154 165 N/A INTRINSIC
low complexity region 179 196 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
low complexity region 303 310 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
low complexity region 355 363 N/A INTRINSIC
PDB:4MP0|D 393 433 8e-22 PDB
low complexity region 502 517 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
low complexity region 566 578 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 644 759 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 815 853 N/A INTRINSIC
ZnF_C3H1 855 881 5.76e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000087211
AA Change: T398A

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084461
Gene: ENSMUSG00000039220
AA Change: T398A

DomainStartEndE-ValueType
TFS2N 74 146 2.23e-22 SMART
low complexity region 154 165 N/A INTRINSIC
low complexity region 179 196 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
low complexity region 303 310 N/A INTRINSIC
low complexity region 335 346 N/A INTRINSIC
low complexity region 355 363 N/A INTRINSIC
PDB:4MP0|D 393 433 8e-22 PDB
low complexity region 502 517 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
low complexity region 566 578 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 644 759 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 815 853 N/A INTRINSIC
ZnF_C3H1 855 881 5.76e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151375
Predicted Effect probably benign
Transcript: ENSMUST00000151664
Meta Mutation Damage Score 0.1008 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein phosphatase 1 binding protein. The encoded protein plays a role in many cellular processes including cell cycle progression, DNA repair and apoptosis by regulating the activity of protein phosphatase 1. This gene lies within the major histocompatibility complex class I region on chromosome 6, and alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik A G 8: 12,279,635 Q30R unknown Het
Bmper A G 9: 23,483,941 N656S probably benign Het
Cic T A 7: 25,273,221 D792E probably damaging Het
Dab1 G A 4: 104,680,146 C192Y probably benign Het
Ddx6 G T 9: 44,614,256 L103F probably damaging Het
Fhod1 T C 8: 105,332,911 K714R probably null Het
Flt1 T C 5: 147,594,621 Q844R possibly damaging Het
Fnip1 T C 11: 54,502,424 I562T probably damaging Het
Fxr2 T A 11: 69,639,427 I40N probably damaging Het
Gm5065 G T 7: 5,359,669 D100Y probably benign Het
Gm7168 A G 17: 13,949,855 K495E probably benign Het
Gria2 C T 3: 80,732,085 V207I probably benign Het
Ifna6 G C 4: 88,827,862 R149S probably benign Het
Ifna6 C A 4: 88,827,849 T145K probably benign Het
Igf2r T C 17: 12,686,724 H2240R probably damaging Het
Ighv8-9 G A 12: 115,468,446 P82S probably benign Het
Itpr3 T C 17: 27,091,551 V436A probably benign Het
Ldb3 T G 14: 34,529,503 D609A probably damaging Het
Luc7l C A 17: 26,266,361 Q112K probably damaging Het
March4 C T 1: 72,452,575 R179H probably damaging Het
Myt1l A G 12: 29,910,789 T75A probably benign Het
Olfr1094 A T 2: 86,828,854 D34V probably benign Het
Olfr1100 A T 2: 86,978,461 C112S possibly damaging Het
Parp4 C T 14: 56,613,724 T728M probably damaging Het
Ppp4c A T 7: 126,792,100 I20N probably damaging Het
Rph3a C T 5: 120,947,927 G482D probably damaging Het
Rtel1 T A 2: 181,349,972 F388I probably benign Het
Slc12a6 G A 2: 112,347,317 V594I probably benign Het
Slc2a4 G A 11: 69,946,116 S134F probably damaging Het
Tead4 A T 6: 128,248,099 probably null Het
Usp40 G A 1: 87,949,979 Q1152* probably null Het
Other mutations in Ppp1r10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Ppp1r10 APN 17 35924859 missense probably damaging 0.99
IGL01113:Ppp1r10 APN 17 35929559 missense probably damaging 0.98
IGL01144:Ppp1r10 APN 17 35926564 missense probably benign 0.28
IGL01650:Ppp1r10 APN 17 35931161 missense unknown
IGL02445:Ppp1r10 APN 17 35926202 missense probably damaging 1.00
IGL02715:Ppp1r10 APN 17 35930712 missense unknown
IGL02797:Ppp1r10 APN 17 35928012 critical splice donor site probably null
IGL03181:Ppp1r10 APN 17 35930624 nonsense probably null
R1183:Ppp1r10 UTSW 17 35929443 missense possibly damaging 0.56
R1710:Ppp1r10 UTSW 17 35926536 missense probably damaging 0.96
R2166:Ppp1r10 UTSW 17 35930589 missense unknown
R2898:Ppp1r10 UTSW 17 35928892 missense probably damaging 1.00
R3692:Ppp1r10 UTSW 17 35930868 missense unknown
R4612:Ppp1r10 UTSW 17 35927931 missense probably damaging 1.00
R4716:Ppp1r10 UTSW 17 35929460 missense probably benign 0.16
R4796:Ppp1r10 UTSW 17 35924087 missense probably damaging 1.00
R4997:Ppp1r10 UTSW 17 35924084 missense probably damaging 1.00
R5152:Ppp1r10 UTSW 17 35929252 missense probably damaging 1.00
R5186:Ppp1r10 UTSW 17 35928511 missense probably damaging 1.00
R5364:Ppp1r10 UTSW 17 35930432 missense unknown
R5705:Ppp1r10 UTSW 17 35929489 missense probably damaging 1.00
R5847:Ppp1r10 UTSW 17 35926847 missense possibly damaging 0.85
R6912:Ppp1r10 UTSW 17 35929561 missense possibly damaging 0.70
R6974:Ppp1r10 UTSW 17 35929551 missense probably benign 0.03
R7169:Ppp1r10 UTSW 17 35929473 missense probably damaging 1.00
R7302:Ppp1r10 UTSW 17 35930881 missense unknown
R7403:Ppp1r10 UTSW 17 35929434 missense probably benign 0.05
R7427:Ppp1r10 UTSW 17 35930133 missense possibly damaging 0.53
Z1088:Ppp1r10 UTSW 17 35930767 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGAGCTCATGGATGCAGGTAAC -3'
(R):5'- CGGTCAGACAGTATCTCACG -3'

Sequencing Primer
(F):5'- GTAACTTACTGAGCCTGGGC -3'
(R):5'- GGTCAGACAGTATCTCACGCTTAG -3'
Posted On2014-12-04