Incidental Mutation 'R2866:Rab23'
ID253198
Institutional Source Beutler Lab
Gene Symbol Rab23
Ensembl Gene ENSMUSG00000004768
Gene NameRAB23, member RAS oncogene family
Synonyms
MMRRC Submission 040455-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2866 (G1)
Quality Score206
Status Not validated
Chromosome1
Chromosomal Location33719887-33742564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33738295 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 163 (K163N)
Ref Sequence ENSEMBL: ENSMUSP00000110828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088287] [ENSMUST00000115174] [ENSMUST00000138024]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088287
AA Change: K163N

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000085625
Gene: ENSMUSG00000004768
AA Change: K163N

DomainStartEndE-ValueType
RAB 10 172 7.79e-58 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115174
AA Change: K163N

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110828
Gene: ENSMUSG00000004768
AA Change: K163N

DomainStartEndE-ValueType
RAB 10 172 7.79e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132066
Predicted Effect probably benign
Transcript: ENSMUST00000138024
SMART Domains Protein: ENSMUSP00000137896
Gene: ENSMUSG00000004768

DomainStartEndE-ValueType
Pfam:Miro 11 59 1.9e-6 PFAM
Pfam:Ras 11 61 6.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151482
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small GTPase of the Ras superfamily. Rab proteins are involved in the regulation of diverse cellular functions associated with intracellular membrane trafficking, including autophagy and immune response to bacterial infection. The encoded protein may play a role in central nervous system development by antagonizing sonic hedgehog signaling. Disruption of this gene has been implicated in Carpenter syndrome as well as cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a spontaneous allele show neural tube defects, exencephaly, spinal cord and dorsal root ganglia anomalies, malformed eyes and defects in the axial skeleton and developing limbs. Mice homozygous for an ENU-induced allele die in utero with exencephaly, polydactyly and eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin T A 8: 116,956,373 D257E probably benign Het
Best1 T C 19: 9,986,221 E532G probably benign Het
Cenpj T C 14: 56,552,180 H804R probably benign Het
Clec2g T C 6: 128,948,756 S43P probably benign Het
Col8a2 A G 4: 126,311,199 probably benign Het
Cpz T C 5: 35,502,361 K647E probably benign Het
Csmd2 T C 4: 128,414,392 probably null Het
Ctss A G 3: 95,545,406 K166R probably benign Het
Cyp2c23 T C 19: 44,005,446 R494G probably damaging Het
Cyp2c68 A G 19: 39,689,145 I467T probably damaging Het
Dcaf11 A T 14: 55,565,745 T299S possibly damaging Het
Dennd1b A G 1: 139,170,281 S762G possibly damaging Het
Epb42 C T 2: 121,025,921 A381T possibly damaging Het
Fhad1 A G 4: 141,920,788 Y256H probably benign Het
Gfra1 C T 19: 58,239,307 A395T possibly damaging Het
Gm10323 C A 13: 66,854,510 C55F probably benign Het
Gm9573 T C 17: 35,619,707 probably benign Het
Greb1 T C 12: 16,699,550 S1092G probably damaging Het
Grid1 A T 14: 35,562,559 D753V probably damaging Het
Grin2b A G 6: 135,733,639 F970L probably damaging Het
Kcnma1 A T 14: 23,373,207 N682K probably benign Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Lcat C T 8: 105,939,879 C337Y probably damaging Het
Mapk10 C T 5: 103,038,682 D25N probably benign Het
Mroh7 C T 4: 106,691,090 G1064R probably damaging Het
Olfr1089 A T 2: 86,733,429 F61Y possibly damaging Het
Olfr1564 T A 17: 33,216,278 H22L probably benign Het
Olfr467 T A 7: 107,814,919 C112S probably benign Het
Olfr615 A T 7: 103,560,857 I127F probably damaging Het
Psg27 T A 7: 18,561,893 D209V probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Pzp A G 6: 128,525,264 S41P possibly damaging Het
Rilpl2 T C 5: 124,477,835 D84G probably damaging Het
Sorl1 A G 9: 41,969,781 I2148T probably benign Het
Tead1 A G 7: 112,759,487 E2G probably damaging Het
Tigd4 A G 3: 84,593,952 N59D possibly damaging Het
Tmprss15 T A 16: 79,035,233 D345V possibly damaging Het
Togaram2 T C 17: 71,709,597 S649P probably benign Het
Ucp2 T C 7: 100,497,252 V95A probably benign Het
Usp17lb T C 7: 104,840,748 D323G probably damaging Het
Zfp677 A T 17: 21,397,256 K192* probably null Het
Zmym2 T A 14: 56,928,248 I676K probably damaging Het
Znrd1as A T 17: 36,965,160 R211S possibly damaging Het
Other mutations in Rab23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02531:Rab23 APN 1 33738280 splice site probably benign
R0309:Rab23 UTSW 1 33734861 splice site probably null
R0798:Rab23 UTSW 1 33734827 missense probably damaging 0.99
R1549:Rab23 UTSW 1 33738297 missense possibly damaging 0.91
R1668:Rab23 UTSW 1 33734854 nonsense probably null
R1976:Rab23 UTSW 1 33723938 missense probably damaging 0.99
R2240:Rab23 UTSW 1 33739325 missense probably benign
R4476:Rab23 UTSW 1 33724892 intron probably benign
R4614:Rab23 UTSW 1 33739385 missense probably benign 0.01
R5884:Rab23 UTSW 1 33724886 intron probably benign
R5939:Rab23 UTSW 1 33723909 missense probably damaging 1.00
X0018:Rab23 UTSW 1 33738336 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGACTGCTCAAATAATTTCTTCC -3'
(R):5'- TGAGCCGGTTACACAATAGG -3'

Sequencing Primer
(F):5'- GACTTGAACTCAGGACCTTCGTAAG -3'
(R):5'- CACAATAGGTGCAGCAACAG -3'
Posted On2014-12-04