Incidental Mutation 'R2866:Ctss'
ID253216
Institutional Source Beutler Lab
Gene Symbol Ctss
Ensembl Gene ENSMUSG00000038642
Gene Namecathepsin S
SynonymsCat S
MMRRC Submission 040455-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R2866 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95526786-95556403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95545406 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 166 (K166R)
Ref Sequence ENSEMBL: ENSMUSP00000112006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015667] [ENSMUST00000116304]
PDB Structure
[]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
Mouse cathepsin s with covalent ligand (3S,4S)-N-[(2E)-2-IMINOETHYL]-4-(MORPHOLIN-4-YLCARBONYL)-1-(PHENYLSULFONYL)PYRROLIDINE-3-CARBOXAMIDE [X-RAY DIFFRACTION]
Mouse cathepsin s with covalent ligand (3S,4S)-1-[(2-CHLOROPHENYL)SULFONYL]-N-[(2E)-2-IMINOETHYL]-4-(MORPHOLIN-4-YLCARBONYL)PYRROLIDINE-3-CARBOXAMIDE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000015667
AA Change: K167R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000015667
Gene: ENSMUSG00000038642
AA Change: K167R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Inhibitor_I29 39 99 2.3e-27 SMART
Pept_C1 126 342 2.3e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116304
AA Change: K166R

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112006
Gene: ENSMUSG00000038642
AA Change: K166R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Inhibitor_I29 36 96 3.01e-23 SMART
Pept_C1 123 339 6.79e-120 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, which encode preproproteins that are proteolytically processed to generate mature protein products. This enzyme is secreted by antigen-presenting cells during inflammation and may induce pain and itch via activation of G-protein coupled receptors. Homozygous knockout mice for this gene exhibit impaired wound healing, reduced tumorigenesis in a pancreatic cancer model, and reduced pathogenesis in a myasthenia gravis model. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice are resistant to the development of experimental autoimmune myasthenia gravis and showed reduced T and B cell responses to acetylcholine receptor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin T A 8: 116,956,373 D257E probably benign Het
Best1 T C 19: 9,986,221 E532G probably benign Het
Cenpj T C 14: 56,552,180 H804R probably benign Het
Clec2g T C 6: 128,948,756 S43P probably benign Het
Col8a2 A G 4: 126,311,199 probably benign Het
Cpz T C 5: 35,502,361 K647E probably benign Het
Csmd2 T C 4: 128,414,392 probably null Het
Cyp2c23 T C 19: 44,005,446 R494G probably damaging Het
Cyp2c68 A G 19: 39,689,145 I467T probably damaging Het
Dcaf11 A T 14: 55,565,745 T299S possibly damaging Het
Dennd1b A G 1: 139,170,281 S762G possibly damaging Het
Epb42 C T 2: 121,025,921 A381T possibly damaging Het
Fhad1 A G 4: 141,920,788 Y256H probably benign Het
Gfra1 C T 19: 58,239,307 A395T possibly damaging Het
Gm10323 C A 13: 66,854,510 C55F probably benign Het
Gm9573 T C 17: 35,619,707 probably benign Het
Greb1 T C 12: 16,699,550 S1092G probably damaging Het
Grid1 A T 14: 35,562,559 D753V probably damaging Het
Grin2b A G 6: 135,733,639 F970L probably damaging Het
Kcnma1 A T 14: 23,373,207 N682K probably benign Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Lcat C T 8: 105,939,879 C337Y probably damaging Het
Mapk10 C T 5: 103,038,682 D25N probably benign Het
Mroh7 C T 4: 106,691,090 G1064R probably damaging Het
Olfr1089 A T 2: 86,733,429 F61Y possibly damaging Het
Olfr1564 T A 17: 33,216,278 H22L probably benign Het
Olfr467 T A 7: 107,814,919 C112S probably benign Het
Olfr615 A T 7: 103,560,857 I127F probably damaging Het
Psg27 T A 7: 18,561,893 D209V probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Pzp A G 6: 128,525,264 S41P possibly damaging Het
Rab23 A T 1: 33,738,295 K163N possibly damaging Het
Rilpl2 T C 5: 124,477,835 D84G probably damaging Het
Sorl1 A G 9: 41,969,781 I2148T probably benign Het
Tead1 A G 7: 112,759,487 E2G probably damaging Het
Tigd4 A G 3: 84,593,952 N59D possibly damaging Het
Tmprss15 T A 16: 79,035,233 D345V possibly damaging Het
Togaram2 T C 17: 71,709,597 S649P probably benign Het
Ucp2 T C 7: 100,497,252 V95A probably benign Het
Usp17lb T C 7: 104,840,748 D323G probably damaging Het
Zfp677 A T 17: 21,397,256 K192* probably null Het
Zmym2 T A 14: 56,928,248 I676K probably damaging Het
Znrd1as A T 17: 36,965,160 R211S possibly damaging Het
Other mutations in Ctss
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Ctss APN 3 95538725 missense probably damaging 1.00
IGL02162:Ctss APN 3 95546821 missense probably benign 0.26
IGL03026:Ctss APN 3 95538830 missense probably benign 0.01
IGL03219:Ctss APN 3 95543100 missense possibly damaging 0.88
clip UTSW 3 95545384 nonsense probably null
R0025:Ctss UTSW 3 95550137 missense probably damaging 1.00
R0025:Ctss UTSW 3 95550137 missense probably damaging 1.00
R0033:Ctss UTSW 3 95545577 splice site probably benign
R0033:Ctss UTSW 3 95545577 splice site probably benign
R1844:Ctss UTSW 3 95546794 critical splice acceptor site probably null
R4061:Ctss UTSW 3 95543034 missense probably benign 0.34
R4846:Ctss UTSW 3 95545384 nonsense probably null
R5917:Ctss UTSW 3 95543113 missense probably benign 0.00
R6443:Ctss UTSW 3 95546803 missense probably benign 0.00
R6555:Ctss UTSW 3 95543029 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGCCTTCCAATGGTCTGAG -3'
(R):5'- ATAGGGCTCTAGAAGGGGTC -3'

Sequencing Primer
(F):5'- CCTTCCAATGGTCTGAGAGAGAAG -3'
(R):5'- GCTCTAGAAGGGGTCAGTGC -3'
Posted On2014-12-04