Incidental Mutation 'R2866:Lat2'
ID253232
Institutional Source Beutler Lab
Gene Symbol Lat2
Ensembl Gene ENSMUSG00000040751
Gene Namelinker for activation of T cells family, member 2
SynonymsWbscr15, Wbscr5
MMRRC Submission 040455-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R2866 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location134600022-134615025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134605944 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 114 (D114V)
Ref Sequence ENSEMBL: ENSMUSP00000144611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023867] [ENSMUST00000036362] [ENSMUST00000077636] [ENSMUST00000200737] [ENSMUST00000200998] [ENSMUST00000202085]
Predicted Effect probably benign
Transcript: ENSMUST00000023867
SMART Domains Protein: ENSMUSP00000023867
Gene: ENSMUSG00000023104

DomainStartEndE-ValueType
AAA 63 189 9.42e-13 SMART
Pfam:Rep_fac_C 253 338 3.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000036362
AA Change: D110V

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046900
Gene: ENSMUSG00000040751
AA Change: D110V

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:LAT2 29 197 6.6e-82 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000077636
AA Change: D98V

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076824
Gene: ENSMUSG00000040751
AA Change: D98V

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200737
SMART Domains Protein: ENSMUSP00000143998
Gene: ENSMUSG00000040751

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:LAT2 29 114 9.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200945
Predicted Effect possibly damaging
Transcript: ENSMUST00000200998
AA Change: D110V

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143977
Gene: ENSMUSG00000040751
AA Change: D110V

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:LAT2 29 197 6.6e-82 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000201632
AA Change: D7V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201832
Predicted Effect probably damaging
Transcript: ENSMUST00000202085
AA Change: D114V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144611
Gene: ENSMUSG00000040751
AA Change: D114V

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:LAT2 29 116 7.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202746
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of the contiguous genes at 7q11.23 commonly deleted in Williams syndrome, a multisystem developmental disorder. This gene consists of at least 14 exons, and its alternative splicing generates 3 transcript variants, all encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have abnormal mast cell physiology and increased anti-nuclear antigen antibody level. Mice homozygous for another null allele show abnormal mast cell physiology, hyperactivated T cells, higher cytokine production, spleenhyperplasia and increased autoantibody level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin T A 8: 116,956,373 D257E probably benign Het
Best1 T C 19: 9,986,221 E532G probably benign Het
Cenpj T C 14: 56,552,180 H804R probably benign Het
Clec2g T C 6: 128,948,756 S43P probably benign Het
Col8a2 A G 4: 126,311,199 probably benign Het
Cpz T C 5: 35,502,361 K647E probably benign Het
Csmd2 T C 4: 128,414,392 probably null Het
Ctss A G 3: 95,545,406 K166R probably benign Het
Cyp2c23 T C 19: 44,005,446 R494G probably damaging Het
Cyp2c68 A G 19: 39,689,145 I467T probably damaging Het
Dcaf11 A T 14: 55,565,745 T299S possibly damaging Het
Dennd1b A G 1: 139,170,281 S762G possibly damaging Het
Epb42 C T 2: 121,025,921 A381T possibly damaging Het
Fhad1 A G 4: 141,920,788 Y256H probably benign Het
Gfra1 C T 19: 58,239,307 A395T possibly damaging Het
Gm10323 C A 13: 66,854,510 C55F probably benign Het
Gm9573 T C 17: 35,619,707 probably benign Het
Greb1 T C 12: 16,699,550 S1092G probably damaging Het
Grid1 A T 14: 35,562,559 D753V probably damaging Het
Grin2b A G 6: 135,733,639 F970L probably damaging Het
Kcnma1 A T 14: 23,373,207 N682K probably benign Het
Lcat C T 8: 105,939,879 C337Y probably damaging Het
Mapk10 C T 5: 103,038,682 D25N probably benign Het
Mroh7 C T 4: 106,691,090 G1064R probably damaging Het
Olfr1089 A T 2: 86,733,429 F61Y possibly damaging Het
Olfr1564 T A 17: 33,216,278 H22L probably benign Het
Olfr467 T A 7: 107,814,919 C112S probably benign Het
Olfr615 A T 7: 103,560,857 I127F probably damaging Het
Psg27 T A 7: 18,561,893 D209V probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Pzp A G 6: 128,525,264 S41P possibly damaging Het
Rab23 A T 1: 33,738,295 K163N possibly damaging Het
Rilpl2 T C 5: 124,477,835 D84G probably damaging Het
Sorl1 A G 9: 41,969,781 I2148T probably benign Het
Tead1 A G 7: 112,759,487 E2G probably damaging Het
Tigd4 A G 3: 84,593,952 N59D possibly damaging Het
Tmprss15 T A 16: 79,035,233 D345V possibly damaging Het
Togaram2 T C 17: 71,709,597 S649P probably benign Het
Ucp2 T C 7: 100,497,252 V95A probably benign Het
Usp17lb T C 7: 104,840,748 D323G probably damaging Het
Zfp677 A T 17: 21,397,256 K192* probably null Het
Zmym2 T A 14: 56,928,248 I676K probably damaging Het
Znrd1as A T 17: 36,965,160 R211S possibly damaging Het
Other mutations in Lat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Lat2 APN 5 134606776 critical splice donor site probably null
IGL01897:Lat2 APN 5 134606627 splice site probably benign
IGL02869:Lat2 APN 5 134608173 missense probably damaging 1.00
IGL03018:Lat2 APN 5 134602591 missense probably damaging 0.97
R0735:Lat2 UTSW 5 134606783 missense probably damaging 1.00
R1739:Lat2 UTSW 5 134606369 missense possibly damaging 0.93
R2257:Lat2 UTSW 5 134602627 missense probably damaging 1.00
R4675:Lat2 UTSW 5 134606057 missense probably damaging 0.99
R5008:Lat2 UTSW 5 134603137 missense probably benign 0.02
R6014:Lat2 UTSW 5 134603454 missense probably damaging 1.00
R6422:Lat2 UTSW 5 134603161 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTCCAAATGGCCAGGATG -3'
(R):5'- AAGGTCTGGCCATTCAAAGC -3'

Sequencing Primer
(F):5'- CCAGGATGGGTGGCTACC -3'
(R):5'- TCTAGCCTAGCCTAGCCTAGCAG -3'
Posted On2014-12-04