Incidental Mutation 'R2866:Grin2b'
ID 253238
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Name glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms GluRepsilon2, GluN2B, NR2B, NMDAR2B, Nmdar2b
MMRRC Submission 040455-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2866 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 135690231-136150509 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 135710637 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 970 (F970L)
Ref Sequence ENSEMBL: ENSMUSP00000107536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000053880
AA Change: F970L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: F970L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111905
AA Change: F970L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: F970L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136027
Meta Mutation Damage Score 0.3681 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin T A 8: 117,683,112 (GRCm39) D257E probably benign Het
Best1 T C 19: 9,963,585 (GRCm39) E532G probably benign Het
Cenpj T C 14: 56,789,637 (GRCm39) H804R probably benign Het
Clec2g T C 6: 128,925,719 (GRCm39) S43P probably benign Het
Col8a2 A G 4: 126,204,992 (GRCm39) probably benign Het
Cpz T C 5: 35,659,705 (GRCm39) K647E probably benign Het
Csmd2 T C 4: 128,308,185 (GRCm39) probably null Het
Ctss A G 3: 95,452,717 (GRCm39) K166R probably benign Het
Cyp2c23 T C 19: 43,993,885 (GRCm39) R494G probably damaging Het
Cyp2c68 A G 19: 39,677,589 (GRCm39) I467T probably damaging Het
Dcaf11 A T 14: 55,803,202 (GRCm39) T299S possibly damaging Het
Dennd1b A G 1: 139,098,019 (GRCm39) S762G possibly damaging Het
Epb42 C T 2: 120,856,402 (GRCm39) A381T possibly damaging Het
Fhad1 A G 4: 141,648,099 (GRCm39) Y256H probably benign Het
Gfra1 C T 19: 58,227,739 (GRCm39) A395T possibly damaging Het
Gm10323 C A 13: 67,002,574 (GRCm39) C55F probably benign Het
Greb1 T C 12: 16,749,551 (GRCm39) S1092G probably damaging Het
Grid1 A T 14: 35,284,516 (GRCm39) D753V probably damaging Het
Kcnma1 A T 14: 23,423,275 (GRCm39) N682K probably benign Het
Lat2 T A 5: 134,634,798 (GRCm39) D114V probably damaging Het
Lcat C T 8: 106,666,511 (GRCm39) C337Y probably damaging Het
Mapk10 C T 5: 103,186,548 (GRCm39) D25N probably benign Het
Mroh7 C T 4: 106,548,287 (GRCm39) G1064R probably damaging Het
Muc21 T C 17: 35,930,599 (GRCm39) probably benign Het
Or10h5 T A 17: 33,435,252 (GRCm39) H22L probably benign Het
Or51ah3 A T 7: 103,210,064 (GRCm39) I127F probably damaging Het
Or5p5 T A 7: 107,414,126 (GRCm39) C112S probably benign Het
Or8k39 A T 2: 86,563,773 (GRCm39) F61Y possibly damaging Het
Polr1has A T 17: 37,276,052 (GRCm39) R211S possibly damaging Het
Psg27 T A 7: 18,295,818 (GRCm39) D209V probably benign Het
Ptgir A G 7: 16,640,794 (GRCm39) M29V possibly damaging Het
Pzp A G 6: 128,502,227 (GRCm39) S41P possibly damaging Het
Rab23 A T 1: 33,777,376 (GRCm39) K163N possibly damaging Het
Rilpl2 T C 5: 124,615,898 (GRCm39) D84G probably damaging Het
Sorl1 A G 9: 41,881,077 (GRCm39) I2148T probably benign Het
Tead1 A G 7: 112,358,694 (GRCm39) E2G probably damaging Het
Tigd4 A G 3: 84,501,259 (GRCm39) N59D possibly damaging Het
Tmprss15 T A 16: 78,832,121 (GRCm39) D345V possibly damaging Het
Togaram2 T C 17: 72,016,592 (GRCm39) S649P probably benign Het
Ucp2 T C 7: 100,146,459 (GRCm39) V95A probably benign Het
Usp17lb T C 7: 104,489,955 (GRCm39) D323G probably damaging Het
Zfp677 A T 17: 21,617,518 (GRCm39) K192* probably null Het
Zmym2 T A 14: 57,165,705 (GRCm39) I676K probably damaging Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135,713,329 (GRCm39) missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135,710,568 (GRCm39) missense probably damaging 1.00
IGL01401:Grin2b APN 6 135,713,361 (GRCm39) missense probably damaging 1.00
IGL01523:Grin2b APN 6 136,021,263 (GRCm39) missense probably null 0.99
IGL01719:Grin2b APN 6 135,710,379 (GRCm39) missense probably damaging 0.97
IGL01907:Grin2b APN 6 135,710,738 (GRCm39) missense probably damaging 1.00
IGL01996:Grin2b APN 6 135,709,584 (GRCm39) missense probably damaging 1.00
IGL02309:Grin2b APN 6 135,713,470 (GRCm39) missense probably damaging 1.00
IGL02312:Grin2b APN 6 135,716,088 (GRCm39) missense probably damaging 1.00
IGL02409:Grin2b APN 6 136,020,906 (GRCm39) missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135,900,389 (GRCm39) missense probably damaging 1.00
IGL02535:Grin2b APN 6 135,756,367 (GRCm39) missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135,899,996 (GRCm39) missense probably damaging 1.00
IGL02702:Grin2b APN 6 135,716,130 (GRCm39) missense probably damaging 0.99
IGL03001:Grin2b APN 6 135,716,113 (GRCm39) missense probably damaging 1.00
IGL03274:Grin2b APN 6 135,757,253 (GRCm39) missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135,900,201 (GRCm39) missense probably benign
R0055:Grin2b UTSW 6 135,900,201 (GRCm39) missense probably benign
R0164:Grin2b UTSW 6 135,755,646 (GRCm39) splice site probably benign
R0194:Grin2b UTSW 6 135,756,303 (GRCm39) missense probably damaging 1.00
R0594:Grin2b UTSW 6 135,710,927 (GRCm39) missense probably damaging 1.00
R1434:Grin2b UTSW 6 135,820,193 (GRCm39) missense probably benign 0.04
R1928:Grin2b UTSW 6 136,021,044 (GRCm39) missense probably damaging 1.00
R1942:Grin2b UTSW 6 135,709,730 (GRCm39) missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136,021,209 (GRCm39) missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135,710,243 (GRCm39) missense probably damaging 1.00
R2020:Grin2b UTSW 6 135,710,894 (GRCm39) missense probably benign 0.12
R2103:Grin2b UTSW 6 135,757,138 (GRCm39) missense probably benign 0.02
R2127:Grin2b UTSW 6 135,755,698 (GRCm39) missense probably benign 0.03
R2495:Grin2b UTSW 6 135,710,180 (GRCm39) missense probably damaging 1.00
R2656:Grin2b UTSW 6 135,710,427 (GRCm39) missense probably damaging 1.00
R2847:Grin2b UTSW 6 135,717,951 (GRCm39) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R3196:Grin2b UTSW 6 135,709,453 (GRCm39) small deletion probably benign
R3418:Grin2b UTSW 6 135,820,108 (GRCm39) missense probably benign 0.02
R3808:Grin2b UTSW 6 135,900,269 (GRCm39) missense probably damaging 0.99
R4028:Grin2b UTSW 6 135,713,433 (GRCm39) missense probably damaging 1.00
R4602:Grin2b UTSW 6 135,755,739 (GRCm39) missense probably damaging 1.00
R4624:Grin2b UTSW 6 135,710,823 (GRCm39) missense probably damaging 0.99
R4677:Grin2b UTSW 6 135,751,870 (GRCm39) missense probably benign 0.13
R4744:Grin2b UTSW 6 135,755,697 (GRCm39) missense probably damaging 1.00
R5020:Grin2b UTSW 6 135,710,405 (GRCm39) missense probably benign 0.01
R5051:Grin2b UTSW 6 135,756,393 (GRCm39) missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135,709,439 (GRCm39) missense probably benign 0.03
R5125:Grin2b UTSW 6 135,900,297 (GRCm39) missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135,756,340 (GRCm39) missense probably damaging 1.00
R5318:Grin2b UTSW 6 135,710,916 (GRCm39) missense probably damaging 0.99
R5349:Grin2b UTSW 6 136,021,281 (GRCm39) missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135,709,366 (GRCm39) missense probably damaging 1.00
R5438:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5439:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5440:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5530:Grin2b UTSW 6 135,710,721 (GRCm39) missense probably benign 0.00
R5603:Grin2b UTSW 6 135,900,395 (GRCm39) missense probably damaging 1.00
R5657:Grin2b UTSW 6 135,710,085 (GRCm39) missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135,717,962 (GRCm39) missense probably benign 0.24
R5941:Grin2b UTSW 6 135,713,371 (GRCm39) missense probably damaging 0.99
R6057:Grin2b UTSW 6 135,710,942 (GRCm39) missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135,900,456 (GRCm39) missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135,749,397 (GRCm39) missense probably damaging 1.00
R6309:Grin2b UTSW 6 135,710,025 (GRCm39) missense probably benign 0.00
R6316:Grin2b UTSW 6 135,757,277 (GRCm39) missense probably benign 0.00
R6419:Grin2b UTSW 6 135,717,965 (GRCm39) missense probably damaging 1.00
R6551:Grin2b UTSW 6 135,710,342 (GRCm39) missense probably damaging 1.00
R6612:Grin2b UTSW 6 135,717,996 (GRCm39) missense probably damaging 1.00
R6616:Grin2b UTSW 6 135,709,549 (GRCm39) missense probably benign
R6647:Grin2b UTSW 6 135,710,108 (GRCm39) missense probably damaging 1.00
R6806:Grin2b UTSW 6 135,751,826 (GRCm39) missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135,757,198 (GRCm39) missense probably benign
R7033:Grin2b UTSW 6 135,900,036 (GRCm39) missense probably damaging 1.00
R7058:Grin2b UTSW 6 135,757,304 (GRCm39) missense probably damaging 0.97
R7144:Grin2b UTSW 6 135,710,474 (GRCm39) missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135,709,946 (GRCm39) missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135,757,249 (GRCm39) missense probably damaging 0.97
R7453:Grin2b UTSW 6 135,717,947 (GRCm39) missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135,749,394 (GRCm39) missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135,756,301 (GRCm39) missense probably damaging 0.99
R7615:Grin2b UTSW 6 135,900,362 (GRCm39) missense probably damaging 1.00
R7632:Grin2b UTSW 6 135,709,553 (GRCm39) missense probably benign 0.02
R7779:Grin2b UTSW 6 135,755,792 (GRCm39) nonsense probably null
R8058:Grin2b UTSW 6 135,710,225 (GRCm39) missense probably damaging 1.00
R8084:Grin2b UTSW 6 135,710,486 (GRCm39) missense probably benign 0.03
R8145:Grin2b UTSW 6 135,709,497 (GRCm39) missense probably benign 0.01
R8308:Grin2b UTSW 6 135,900,074 (GRCm39) missense probably damaging 0.99
R8357:Grin2b UTSW 6 135,709,197 (GRCm39) missense probably benign 0.00
R8379:Grin2b UTSW 6 135,899,967 (GRCm39) missense probably damaging 1.00
R8429:Grin2b UTSW 6 135,710,914 (GRCm39) missense probably damaging 1.00
R8457:Grin2b UTSW 6 135,709,197 (GRCm39) missense probably benign 0.00
R8746:Grin2b UTSW 6 135,899,985 (GRCm39) missense probably benign 0.02
R8925:Grin2b UTSW 6 135,749,339 (GRCm39) missense probably damaging 0.97
R8927:Grin2b UTSW 6 135,749,339 (GRCm39) missense probably damaging 0.97
R8963:Grin2b UTSW 6 136,021,007 (GRCm39) missense probably damaging 1.00
R9075:Grin2b UTSW 6 135,709,509 (GRCm39) frame shift probably null
R9076:Grin2b UTSW 6 135,709,509 (GRCm39) frame shift probably null
R9172:Grin2b UTSW 6 135,756,255 (GRCm39) missense possibly damaging 0.84
R9520:Grin2b UTSW 6 135,710,399 (GRCm39) missense probably damaging 1.00
R9740:Grin2b UTSW 6 135,899,868 (GRCm39) critical splice donor site probably null
RF001:Grin2b UTSW 6 136,021,238 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAACTTGCCGTACAGGTCG -3'
(R):5'- AACCTGTCTGGAGTCAACG -3'

Sequencing Primer
(F):5'- TTGCCGTACAGGTCGCTGAG -3'
(R):5'- TGTCTGGAGTCAACGGCTCC -3'
Posted On 2014-12-04