Incidental Mutation 'R2473:Mucl2'
ID253241
Institutional Source Beutler Lab
Gene Symbol Mucl2
Ensembl Gene ENSMUSG00000036925
Gene Namemucin-like 2
SynonymsSpt-1, Spt1
MMRRC Submission 040404-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R2473 (G1)
Quality Score203
Status Not validated
Chromosome15
Chromosomal Location103895855-103899312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 103897362 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 110 (E110Q)
Ref Sequence ENSEMBL: ENSMUSP00000154772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037685] [ENSMUST00000226584]
Predicted Effect unknown
Transcript: ENSMUST00000037685
AA Change: E110Q
SMART Domains Protein: ENSMUSP00000044814
Gene: ENSMUSG00000036925
AA Change: E110Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000226584
AA Change: E110Q

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8b4 T G 2: 126,358,894 K785Q possibly damaging Het
Cacnb2 G A 2: 14,984,314 D402N probably damaging Het
Cyp3a16 T A 5: 145,455,594 I184F possibly damaging Het
Ephb4 T A 5: 137,365,700 D611E probably benign Het
Habp2 G A 19: 56,288,032 V13M possibly damaging Het
Mamdc4 C A 2: 25,566,332 G713V probably damaging Het
Marveld2 C T 13: 100,597,321 V269M probably damaging Het
Mbd5 T A 2: 49,279,341 M1508K probably benign Het
Mgp T C 6: 136,873,164 probably null Het
Mxra8 T C 4: 155,842,043 F286S probably damaging Het
Olfr1279 T C 2: 111,306,891 S229P probably damaging Het
Olfr325 A G 11: 58,581,575 T244A probably damaging Het
Olfr495 C T 7: 108,395,504 A128V probably damaging Het
Olfr651 T C 7: 104,552,939 Y7H possibly damaging Het
Pax3 C T 1: 78,122,590 probably null Het
Polm T C 11: 5,829,881 E339G possibly damaging Het
Sec14l4 T A 11: 4,043,359 V218E probably benign Het
Sf3b1 C T 1: 54,999,626 probably null Het
Six4 A G 12: 73,104,175 V532A probably benign Het
Slc35c1 T A 2: 92,454,753 D172V probably benign Het
Ttc39a A T 4: 109,442,239 I428F probably damaging Het
Zfp414 CAAACTCTTCCGA CAAACTCTTCCGAAACTCTTCCGA 17: 33,630,577 probably null Het
Other mutations in Mucl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0164:Mucl2 UTSW 15 103899179 splice site probably null
R1468:Mucl2 UTSW 15 103897407 missense possibly damaging 0.66
R1468:Mucl2 UTSW 15 103897407 missense possibly damaging 0.66
R1760:Mucl2 UTSW 15 103897572 missense possibly damaging 0.66
R2188:Mucl2 UTSW 15 103897574 missense probably damaging 0.97
R3792:Mucl2 UTSW 15 103898426 missense possibly damaging 0.66
R5250:Mucl2 UTSW 15 103897467 missense possibly damaging 0.66
R5934:Mucl2 UTSW 15 103897566 missense probably benign 0.27
R7313:Mucl2 UTSW 15 103899179 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGTTGCCATGCTACCTGGAG -3'
(R):5'- TGGCTCTGAAACTCAGGCAG -3'

Sequencing Primer
(F):5'- ATGCTACCTGGAGACACTTTAC -3'
(R):5'- CTCTGAAACTCAGGCAGATAGTACTG -3'
Posted On2014-12-04