Incidental Mutation 'R2866:Ptgir'
ID253242
Institutional Source Beutler Lab
Gene Symbol Ptgir
Ensembl Gene ENSMUSG00000043017
Gene Nameprostaglandin I receptor (IP)
SynonymsIP, prostacyclin receptor
MMRRC Submission 040455-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R2866 (G1)
Quality Score184
Status Not validated
Chromosome7
Chromosomal Location16906490-16910905 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16906869 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 29 (M29V)
Ref Sequence ENSEMBL: ENSMUSP00000122080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086101] [ENSMUST00000144408]
PDB Structure
Molecular analysis of the interaction between the prostacyclin receptor and the first PDZ domain of PDZK1 [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000086101
AA Change: M29V
SMART Domains Protein: ENSMUSP00000083270
Gene: ENSMUSG00000043017
AA Change: M29V

DomainStartEndE-ValueType
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 100 119 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144408
AA Change: M29V

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122080
Gene: ENSMUSG00000043017
AA Change: M29V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 49 291 2.6e-11 PFAM
Pfam:7tm_1 58 319 1.2e-21 PFAM
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor family 1 and has been shown to be a receptor for prostacyclin. Prostacyclin, the major product of cyclooxygenase in macrovascular endothelium, elicits a potent vasodilation and inhibition of platelet aggregation through binding to this receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased susceptibility to thrombosis and injury-induced vascular proliferation, and decreased inflammatory and pain responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin T A 8: 116,956,373 D257E probably benign Het
Best1 T C 19: 9,986,221 E532G probably benign Het
Cenpj T C 14: 56,552,180 H804R probably benign Het
Clec2g T C 6: 128,948,756 S43P probably benign Het
Col8a2 A G 4: 126,311,199 probably benign Het
Cpz T C 5: 35,502,361 K647E probably benign Het
Csmd2 T C 4: 128,414,392 probably null Het
Ctss A G 3: 95,545,406 K166R probably benign Het
Cyp2c23 T C 19: 44,005,446 R494G probably damaging Het
Cyp2c68 A G 19: 39,689,145 I467T probably damaging Het
Dcaf11 A T 14: 55,565,745 T299S possibly damaging Het
Dennd1b A G 1: 139,170,281 S762G possibly damaging Het
Epb42 C T 2: 121,025,921 A381T possibly damaging Het
Fhad1 A G 4: 141,920,788 Y256H probably benign Het
Gfra1 C T 19: 58,239,307 A395T possibly damaging Het
Gm10323 C A 13: 66,854,510 C55F probably benign Het
Gm9573 T C 17: 35,619,707 probably benign Het
Greb1 T C 12: 16,699,550 S1092G probably damaging Het
Grid1 A T 14: 35,562,559 D753V probably damaging Het
Grin2b A G 6: 135,733,639 F970L probably damaging Het
Kcnma1 A T 14: 23,373,207 N682K probably benign Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Lcat C T 8: 105,939,879 C337Y probably damaging Het
Mapk10 C T 5: 103,038,682 D25N probably benign Het
Mroh7 C T 4: 106,691,090 G1064R probably damaging Het
Olfr1089 A T 2: 86,733,429 F61Y possibly damaging Het
Olfr1564 T A 17: 33,216,278 H22L probably benign Het
Olfr467 T A 7: 107,814,919 C112S probably benign Het
Olfr615 A T 7: 103,560,857 I127F probably damaging Het
Psg27 T A 7: 18,561,893 D209V probably benign Het
Pzp A G 6: 128,525,264 S41P possibly damaging Het
Rab23 A T 1: 33,738,295 K163N possibly damaging Het
Rilpl2 T C 5: 124,477,835 D84G probably damaging Het
Sorl1 A G 9: 41,969,781 I2148T probably benign Het
Tead1 A G 7: 112,759,487 E2G probably damaging Het
Tigd4 A G 3: 84,593,952 N59D possibly damaging Het
Tmprss15 T A 16: 79,035,233 D345V possibly damaging Het
Togaram2 T C 17: 71,709,597 S649P probably benign Het
Ucp2 T C 7: 100,497,252 V95A probably benign Het
Usp17lb T C 7: 104,840,748 D323G probably damaging Het
Zfp677 A T 17: 21,397,256 K192* probably null Het
Zmym2 T A 14: 56,928,248 I676K probably damaging Het
Znrd1as A T 17: 36,965,160 R211S possibly damaging Het
Other mutations in Ptgir
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02496:Ptgir APN 7 16907484 missense possibly damaging 0.76
IGL02928:Ptgir APN 7 16908998 missense possibly damaging 0.74
IGL02950:Ptgir APN 7 16907601 missense probably damaging 1.00
R1104:Ptgir UTSW 7 16907130 intron probably null
R2159:Ptgir UTSW 7 16906869 missense possibly damaging 0.88
R2161:Ptgir UTSW 7 16906869 missense possibly damaging 0.88
R2162:Ptgir UTSW 7 16906869 missense possibly damaging 0.88
R2184:Ptgir UTSW 7 16908783 missense probably damaging 1.00
R3845:Ptgir UTSW 7 16907386 missense probably damaging 0.99
R3953:Ptgir UTSW 7 16906869 missense possibly damaging 0.88
R3955:Ptgir UTSW 7 16906869 missense possibly damaging 0.88
R3956:Ptgir UTSW 7 16906869 missense possibly damaging 0.88
R3957:Ptgir UTSW 7 16906869 missense possibly damaging 0.88
R4092:Ptgir UTSW 7 16907007 missense probably damaging 1.00
R4245:Ptgir UTSW 7 16906869 missense possibly damaging 0.88
R4354:Ptgir UTSW 7 16906869 missense possibly damaging 0.88
R4551:Ptgir UTSW 7 16906869 missense possibly damaging 0.88
R4563:Ptgir UTSW 7 16906869 missense possibly damaging 0.88
R4564:Ptgir UTSW 7 16906869 missense possibly damaging 0.88
R4657:Ptgir UTSW 7 16907146 missense probably benign 0.00
R4670:Ptgir UTSW 7 16906869 missense possibly damaging 0.88
R4671:Ptgir UTSW 7 16906869 missense possibly damaging 0.88
R4825:Ptgir UTSW 7 16908843 missense probably damaging 1.00
R4835:Ptgir UTSW 7 16906869 missense possibly damaging 0.88
R5179:Ptgir UTSW 7 16907328 missense probably damaging 1.00
R5226:Ptgir UTSW 7 16908720 missense probably damaging 1.00
R6039:Ptgir UTSW 7 16906890 missense possibly damaging 0.64
R6039:Ptgir UTSW 7 16906890 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGCTGGAGGGTCTAGAAAGC -3'
(R):5'- CAAACACTGCAGGGCTCAAG -3'

Sequencing Primer
(F):5'- CAGGGAACACTGAGGCAC -3'
(R):5'- TCAAGAAGCACGTGCCCAG -3'
Posted On2014-12-04