Incidental Mutation 'R2866:Psg27'
ID253244
Institutional Source Beutler Lab
Gene Symbol Psg27
Ensembl Gene ENSMUSG00000070797
Gene Namepregnancy-specific glycoprotein 27
SynonymsEG545925, cea15
MMRRC Submission 040455-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.019) question?
Stock #R2866 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location18556514-18567305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18561893 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 209 (D209V)
Ref Sequence ENSEMBL: ENSMUSP00000092388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094794]
Predicted Effect probably benign
Transcript: ENSMUST00000094794
AA Change: D209V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092388
Gene: ENSMUSG00000070797
AA Change: D209V

DomainStartEndE-ValueType
IG 39 140 4.13e-5 SMART
IG 159 260 5.89e-1 SMART
IG 279 380 1.39e-2 SMART
IGc2 396 460 3.62e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin T A 8: 116,956,373 D257E probably benign Het
Best1 T C 19: 9,986,221 E532G probably benign Het
Cenpj T C 14: 56,552,180 H804R probably benign Het
Clec2g T C 6: 128,948,756 S43P probably benign Het
Col8a2 A G 4: 126,311,199 probably benign Het
Cpz T C 5: 35,502,361 K647E probably benign Het
Csmd2 T C 4: 128,414,392 probably null Het
Ctss A G 3: 95,545,406 K166R probably benign Het
Cyp2c23 T C 19: 44,005,446 R494G probably damaging Het
Cyp2c68 A G 19: 39,689,145 I467T probably damaging Het
Dcaf11 A T 14: 55,565,745 T299S possibly damaging Het
Dennd1b A G 1: 139,170,281 S762G possibly damaging Het
Epb42 C T 2: 121,025,921 A381T possibly damaging Het
Fhad1 A G 4: 141,920,788 Y256H probably benign Het
Gfra1 C T 19: 58,239,307 A395T possibly damaging Het
Gm10323 C A 13: 66,854,510 C55F probably benign Het
Gm9573 T C 17: 35,619,707 probably benign Het
Greb1 T C 12: 16,699,550 S1092G probably damaging Het
Grid1 A T 14: 35,562,559 D753V probably damaging Het
Grin2b A G 6: 135,733,639 F970L probably damaging Het
Kcnma1 A T 14: 23,373,207 N682K probably benign Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Lcat C T 8: 105,939,879 C337Y probably damaging Het
Mapk10 C T 5: 103,038,682 D25N probably benign Het
Mroh7 C T 4: 106,691,090 G1064R probably damaging Het
Olfr1089 A T 2: 86,733,429 F61Y possibly damaging Het
Olfr1564 T A 17: 33,216,278 H22L probably benign Het
Olfr467 T A 7: 107,814,919 C112S probably benign Het
Olfr615 A T 7: 103,560,857 I127F probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Pzp A G 6: 128,525,264 S41P possibly damaging Het
Rab23 A T 1: 33,738,295 K163N possibly damaging Het
Rilpl2 T C 5: 124,477,835 D84G probably damaging Het
Sorl1 A G 9: 41,969,781 I2148T probably benign Het
Tead1 A G 7: 112,759,487 E2G probably damaging Het
Tigd4 A G 3: 84,593,952 N59D possibly damaging Het
Tmprss15 T A 16: 79,035,233 D345V possibly damaging Het
Togaram2 T C 17: 71,709,597 S649P probably benign Het
Ucp2 T C 7: 100,497,252 V95A probably benign Het
Usp17lb T C 7: 104,840,748 D323G probably damaging Het
Zfp677 A T 17: 21,397,256 K192* probably null Het
Zmym2 T A 14: 56,928,248 I676K probably damaging Het
Znrd1as A T 17: 36,965,160 R211S possibly damaging Het
Other mutations in Psg27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Psg27 APN 7 18561804 missense probably damaging 1.00
IGL00417:Psg27 APN 7 18561917 missense probably benign 0.22
IGL01344:Psg27 APN 7 18560417 missense probably damaging 1.00
IGL01781:Psg27 APN 7 18565064 missense probably damaging 1.00
IGL02547:Psg27 APN 7 18560628 missense probably benign
IGL02926:Psg27 APN 7 18557129 missense probably damaging 0.99
IGL03074:Psg27 APN 7 18560529 missense probably benign 0.02
IGL03237:Psg27 APN 7 18560492 missense probably benign 0.00
IGL02796:Psg27 UTSW 7 18561950 missense probably benign 0.08
R0437:Psg27 UTSW 7 18560711 splice site probably benign
R0604:Psg27 UTSW 7 18557072 missense probably damaging 0.98
R1163:Psg27 UTSW 7 18565309 missense probably damaging 0.99
R2072:Psg27 UTSW 7 18560417 missense probably damaging 1.00
R2072:Psg27 UTSW 7 18565009 missense probably benign 0.16
R2073:Psg27 UTSW 7 18560417 missense probably damaging 1.00
R2074:Psg27 UTSW 7 18560417 missense probably damaging 1.00
R2081:Psg27 UTSW 7 18556958 missense probably damaging 1.00
R2206:Psg27 UTSW 7 18567111 nonsense probably null
R3783:Psg27 UTSW 7 18560354 missense probably damaging 1.00
R3784:Psg27 UTSW 7 18560354 missense probably damaging 1.00
R4463:Psg27 UTSW 7 18557085 missense possibly damaging 0.46
R5312:Psg27 UTSW 7 18557033 missense probably benign 0.43
R5885:Psg27 UTSW 7 18561786 missense probably damaging 0.96
R6087:Psg27 UTSW 7 18556944 missense probably benign 0.05
X0064:Psg27 UTSW 7 18561795 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACATGCCAGCAGTGACAGTG -3'
(R):5'- CCCTGCCAAGCTCACTATTGAATC -3'

Sequencing Primer
(F):5'- TGACAGTGCTCCTGGTAGAAGC -3'
(R):5'- AGCTCACTATTGAATCAGTGCCG -3'
Posted On2014-12-04