Incidental Mutation 'R2866:Olfr615'
ID253250
Institutional Source Beutler Lab
Gene Symbol Olfr615
Ensembl Gene ENSMUSG00000073947
Gene Nameolfactory receptor 615
SynonymsGA_x6K02T2PBJ9-6284902-6285843, MOR19-2
MMRRC Submission 040455-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.034) question?
Stock #R2866 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103556079-103563798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103560857 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 127 (I127F)
Ref Sequence ENSEMBL: ENSMUSP00000150166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098198] [ENSMUST00000106886] [ENSMUST00000214345] [ENSMUST00000214806] [ENSMUST00000215673] [ENSMUST00000217293]
Predicted Effect probably damaging
Transcript: ENSMUST00000098198
AA Change: I127F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095800
Gene: ENSMUSG00000073947
AA Change: I127F

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 2.5e-105 PFAM
Pfam:7TM_GPCR_Srsx 36 253 8.5e-9 PFAM
Pfam:7tm_1 42 293 8.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106886
SMART Domains Protein: ENSMUSP00000102499
Gene: ENSMUSG00000047544

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:7tm_4 33 311 1.1e-116 PFAM
Pfam:7TM_GPCR_Srsx 37 309 1.2e-6 PFAM
Pfam:7tm_1 43 294 4.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214345
AA Change: I127F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214806
Predicted Effect probably damaging
Transcript: ENSMUST00000215673
AA Change: I127F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217293
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin T A 8: 116,956,373 D257E probably benign Het
Best1 T C 19: 9,986,221 E532G probably benign Het
Cenpj T C 14: 56,552,180 H804R probably benign Het
Clec2g T C 6: 128,948,756 S43P probably benign Het
Col8a2 A G 4: 126,311,199 probably benign Het
Cpz T C 5: 35,502,361 K647E probably benign Het
Csmd2 T C 4: 128,414,392 probably null Het
Ctss A G 3: 95,545,406 K166R probably benign Het
Cyp2c23 T C 19: 44,005,446 R494G probably damaging Het
Cyp2c68 A G 19: 39,689,145 I467T probably damaging Het
Dcaf11 A T 14: 55,565,745 T299S possibly damaging Het
Dennd1b A G 1: 139,170,281 S762G possibly damaging Het
Epb42 C T 2: 121,025,921 A381T possibly damaging Het
Fhad1 A G 4: 141,920,788 Y256H probably benign Het
Gfra1 C T 19: 58,239,307 A395T possibly damaging Het
Gm10323 C A 13: 66,854,510 C55F probably benign Het
Gm9573 T C 17: 35,619,707 probably benign Het
Greb1 T C 12: 16,699,550 S1092G probably damaging Het
Grid1 A T 14: 35,562,559 D753V probably damaging Het
Grin2b A G 6: 135,733,639 F970L probably damaging Het
Kcnma1 A T 14: 23,373,207 N682K probably benign Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Lcat C T 8: 105,939,879 C337Y probably damaging Het
Mapk10 C T 5: 103,038,682 D25N probably benign Het
Mroh7 C T 4: 106,691,090 G1064R probably damaging Het
Olfr1089 A T 2: 86,733,429 F61Y possibly damaging Het
Olfr1564 T A 17: 33,216,278 H22L probably benign Het
Olfr467 T A 7: 107,814,919 C112S probably benign Het
Psg27 T A 7: 18,561,893 D209V probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Pzp A G 6: 128,525,264 S41P possibly damaging Het
Rab23 A T 1: 33,738,295 K163N possibly damaging Het
Rilpl2 T C 5: 124,477,835 D84G probably damaging Het
Sorl1 A G 9: 41,969,781 I2148T probably benign Het
Tead1 A G 7: 112,759,487 E2G probably damaging Het
Tigd4 A G 3: 84,593,952 N59D possibly damaging Het
Tmprss15 T A 16: 79,035,233 D345V possibly damaging Het
Togaram2 T C 17: 71,709,597 S649P probably benign Het
Ucp2 T C 7: 100,497,252 V95A probably benign Het
Usp17lb T C 7: 104,840,748 D323G probably damaging Het
Zfp677 A T 17: 21,397,256 K192* probably null Het
Zmym2 T A 14: 56,928,248 I676K probably damaging Het
Znrd1as A T 17: 36,965,160 R211S possibly damaging Het
Other mutations in Olfr615
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Olfr615 APN 7 103561356 missense probably damaging 1.00
IGL01310:Olfr615 APN 7 103560801 missense probably benign
IGL01597:Olfr615 APN 7 103561142 missense possibly damaging 0.79
IGL01725:Olfr615 APN 7 103561075 nonsense probably null
IGL03291:Olfr615 APN 7 103560912 missense possibly damaging 0.93
R0055:Olfr615 UTSW 7 103561037 missense probably damaging 1.00
R0055:Olfr615 UTSW 7 103561037 missense probably damaging 1.00
R0189:Olfr615 UTSW 7 103561082 missense probably benign 0.01
R0254:Olfr615 UTSW 7 103560622 nonsense probably null
R1395:Olfr615 UTSW 7 103561119 missense possibly damaging 0.92
R1781:Olfr615 UTSW 7 103560566 missense probably benign 0.34
R2958:Olfr615 UTSW 7 103561305 missense possibly damaging 0.54
R3922:Olfr615 UTSW 7 103560705 missense probably benign 0.00
R4306:Olfr615 UTSW 7 103561172 nonsense probably null
R4306:Olfr615 UTSW 7 103561173 missense possibly damaging 0.50
R4818:Olfr615 UTSW 7 103560761 missense probably benign 0.07
R4907:Olfr615 UTSW 7 103561034 missense possibly damaging 0.85
R4993:Olfr615 UTSW 7 103561317 missense possibly damaging 0.63
R5461:Olfr615 UTSW 7 103560573 missense probably damaging 1.00
R6225:Olfr615 UTSW 7 103561282 missense probably benign 0.01
R6621:Olfr615 UTSW 7 103560878 missense possibly damaging 0.93
Z1088:Olfr615 UTSW 7 103561059 missense probably benign
Z1088:Olfr615 UTSW 7 103561390 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCACCACATTGGCAGGGAAC -3'
(R):5'- GCCACAGGCTAGTTTCATGAC -3'

Sequencing Primer
(F):5'- GCAGGAGCCTCAGTACCAATTTTTG -3'
(R):5'- CCACAGGCTAGTTTCATGACATTTGG -3'
Posted On2014-12-04