Incidental Mutation 'R2866:Lcat'
ID253258
Institutional Source Beutler Lab
Gene Symbol Lcat
Ensembl Gene ENSMUSG00000035237
Gene Namelecithin cholesterol acyltransferase
SynonymsD8Wsu61e
MMRRC Submission 040455-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R2866 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105939551-105943382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105939879 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 337 (C337Y)
Ref Sequence ENSEMBL: ENSMUSP00000038232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034369] [ENSMUST00000034370] [ENSMUST00000038896] [ENSMUST00000116429]
Predicted Effect probably benign
Transcript: ENSMUST00000034369
SMART Domains Protein: ENSMUSP00000034369
Gene: ENSMUSG00000031897

DomainStartEndE-ValueType
Pfam:Proteasome 36 217 3.9e-49 PFAM
Pfam:Pr_beta_C 231 267 3.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034370
SMART Domains Protein: ENSMUSP00000034370
Gene: ENSMUSG00000017765

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
Pfam:AA_permease 125 318 5.8e-28 PFAM
Pfam:AA_permease 409 698 1.2e-40 PFAM
Pfam:SLC12 710 833 7.1e-18 PFAM
Pfam:SLC12 829 1087 4.8e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000038896
AA Change: C337Y

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038232
Gene: ENSMUSG00000035237
AA Change: C337Y

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:LCAT 81 414 1.7e-111 PFAM
low complexity region 425 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116429
SMART Domains Protein: ENSMUSP00000112130
Gene: ENSMUSG00000017765

DomainStartEndE-ValueType
low complexity region 95 115 N/A INTRINSIC
Pfam:AA_permease 123 309 7.7e-29 PFAM
Pfam:AA_permease_2 390 654 2.9e-17 PFAM
Pfam:AA_permease 404 696 4.4e-39 PFAM
Pfam:KCl_Cotrans_1 953 982 9.2e-21 PFAM
low complexity region 1065 1080 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212938
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the extracellular cholesterol esterifying enzyme, lecithin-cholesterol acyltransferase. The esterification of cholesterol is required for cholesterol transport. Mutations in this gene have been found to cause fish-eye disease as well as LCAT deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes display severe hypoalphalipoproteinemia, variable hypertriglyceridemia, and accumulation of heterogeneous pre-beta HDL, as well as an attenuated increase in apoB-containing lipoproteins in response to dietary cholesterol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin T A 8: 116,956,373 D257E probably benign Het
Best1 T C 19: 9,986,221 E532G probably benign Het
Cenpj T C 14: 56,552,180 H804R probably benign Het
Clec2g T C 6: 128,948,756 S43P probably benign Het
Col8a2 A G 4: 126,311,199 probably benign Het
Cpz T C 5: 35,502,361 K647E probably benign Het
Csmd2 T C 4: 128,414,392 probably null Het
Ctss A G 3: 95,545,406 K166R probably benign Het
Cyp2c23 T C 19: 44,005,446 R494G probably damaging Het
Cyp2c68 A G 19: 39,689,145 I467T probably damaging Het
Dcaf11 A T 14: 55,565,745 T299S possibly damaging Het
Dennd1b A G 1: 139,170,281 S762G possibly damaging Het
Epb42 C T 2: 121,025,921 A381T possibly damaging Het
Fhad1 A G 4: 141,920,788 Y256H probably benign Het
Gfra1 C T 19: 58,239,307 A395T possibly damaging Het
Gm10323 C A 13: 66,854,510 C55F probably benign Het
Gm9573 T C 17: 35,619,707 probably benign Het
Greb1 T C 12: 16,699,550 S1092G probably damaging Het
Grid1 A T 14: 35,562,559 D753V probably damaging Het
Grin2b A G 6: 135,733,639 F970L probably damaging Het
Kcnma1 A T 14: 23,373,207 N682K probably benign Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Mapk10 C T 5: 103,038,682 D25N probably benign Het
Mroh7 C T 4: 106,691,090 G1064R probably damaging Het
Olfr1089 A T 2: 86,733,429 F61Y possibly damaging Het
Olfr1564 T A 17: 33,216,278 H22L probably benign Het
Olfr467 T A 7: 107,814,919 C112S probably benign Het
Olfr615 A T 7: 103,560,857 I127F probably damaging Het
Psg27 T A 7: 18,561,893 D209V probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Pzp A G 6: 128,525,264 S41P possibly damaging Het
Rab23 A T 1: 33,738,295 K163N possibly damaging Het
Rilpl2 T C 5: 124,477,835 D84G probably damaging Het
Sorl1 A G 9: 41,969,781 I2148T probably benign Het
Tead1 A G 7: 112,759,487 E2G probably damaging Het
Tigd4 A G 3: 84,593,952 N59D possibly damaging Het
Tmprss15 T A 16: 79,035,233 D345V possibly damaging Het
Togaram2 T C 17: 71,709,597 S649P probably benign Het
Ucp2 T C 7: 100,497,252 V95A probably benign Het
Usp17lb T C 7: 104,840,748 D323G probably damaging Het
Zfp677 A T 17: 21,397,256 K192* probably null Het
Zmym2 T A 14: 56,928,248 I676K probably damaging Het
Znrd1as A T 17: 36,965,160 R211S possibly damaging Het
Other mutations in Lcat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02494:Lcat APN 8 105941939 unclassified probably benign
IGL02654:Lcat APN 8 105939769 missense possibly damaging 0.68
IGL02678:Lcat APN 8 105941940 splice site probably null
IGL02963:Lcat APN 8 105939956 missense probably damaging 0.99
IGL03304:Lcat APN 8 105940063 missense possibly damaging 0.94
R1754:Lcat UTSW 8 105941814 frame shift probably null
R1757:Lcat UTSW 8 105941814 frame shift probably null
R1824:Lcat UTSW 8 105939888 missense probably damaging 0.98
R1962:Lcat UTSW 8 105941723 missense probably damaging 0.98
R4091:Lcat UTSW 8 105939906 missense probably benign 0.09
R4172:Lcat UTSW 8 105942427 missense possibly damaging 0.56
R4921:Lcat UTSW 8 105942442 missense possibly damaging 0.92
R5487:Lcat UTSW 8 105939664 missense probably benign
R6552:Lcat UTSW 8 105939679 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CATGGGCAGCAAATGTACGG -3'
(R):5'- CTGTCCAACATAAAGCTGAAAGAGG -3'

Sequencing Primer
(F):5'- CAAATGTACGGGCTGCGACTG -3'
(R):5'- ACGACTTCCCCCTGGATG -3'
Posted On2014-12-04