Mutagenetix > Incidental Mutations

Incidental Mutation 'R2866:Lcat'

253258

Institutional Source

Beutler Lab

Gene Symbol

Lcat

Ensembl Gene

ENSMUSG00000035237

Gene Name

lecithin cholesterol acyltransferase

Synonyms

D8Wsu61e

MMRRC Submission

040455-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.216) question?

Stock #

R2866 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105939551-105943382 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 105939879 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 337 (C337Y)

Ref Sequence

ENSEMBL: ENSMUSP00000038232 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034369] [ENSMUST00000034370] [ENSMUST00000038896] [ENSMUST00000116429]

Predicted Effect

probably benign
Transcript: ENSMUST00000034369

SMART Domains

Protein: ENSMUSP00000034369
Gene: ENSMUSG00000031897

Domain	Start	End	E-Value	Type
Pfam:Proteasome	36	217	3.9e-49	PFAM
Pfam:Pr_beta_C	231	267	3.8e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000034370

SMART Domains

Protein: ENSMUSP00000034370
Gene: ENSMUSG00000017765

Domain	Start	End	E-Value	Type
low complexity region	97	117	N/A	INTRINSIC
Pfam:AA_permease	125	318	5.8e-28	PFAM
Pfam:AA_permease	409	698	1.2e-40	PFAM
Pfam:SLC12	710	833	7.1e-18	PFAM
Pfam:SLC12	829	1087	4.8e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000038896
AA Change: C337Y

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000038232
Gene: ENSMUSG00000035237
AA Change: C337Y

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:LCAT	81	414	1.7e-111	PFAM
low complexity region	425	437	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000116429

SMART Domains

Protein: ENSMUSP00000112130
Gene: ENSMUSG00000017765

Domain	Start	End	E-Value	Type
low complexity region	95	115	N/A	INTRINSIC
Pfam:AA_permease	123	309	7.7e-29	PFAM
Pfam:AA_permease_2	390	654	2.9e-17	PFAM
Pfam:AA_permease	404	696	4.4e-39	PFAM
Pfam:KCl_Cotrans_1	953	982	9.2e-21	PFAM
low complexity region	1065	1080	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141168

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212044

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212332

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212595

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212686

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212876

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212938

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the extracellular cholesterol esterifying enzyme, lecithin-cholesterol acyltransferase. The esterification of cholesterol is required for cholesterol transport. Mutations in this gene have been found to cause fish-eye disease as well as LCAT deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes display severe hypoalphalipoproteinemia, variable hypertriglyceridemia, and accumulation of heterogeneous pre-beta HDL, as well as an attenuated increase in apoB-containing lipoproteins in response to dietary cholesterol. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atmin	T	A	8: 116,956,373	D257E	probably benign	Het
Best1	T	C	19: 9,986,221	E532G	probably benign	Het
Cenpj	T	C	14: 56,552,180	H804R	probably benign	Het
Clec2g	T	C	6: 128,948,756	S43P	probably benign	Het
Col8a2	A	G	4: 126,311,199		probably benign	Het
Cpz	T	C	5: 35,502,361	K647E	probably benign	Het
Csmd2	T	C	4: 128,414,392		probably null	Het
Ctss	A	G	3: 95,545,406	K166R	probably benign	Het
Cyp2c23	T	C	19: 44,005,446	R494G	probably damaging	Het
Cyp2c68	A	G	19: 39,689,145	I467T	probably damaging	Het
Dcaf11	A	T	14: 55,565,745	T299S	possibly damaging	Het
Dennd1b	A	G	1: 139,170,281	S762G	possibly damaging	Het
Epb42	C	T	2: 121,025,921	A381T	possibly damaging	Het
Fhad1	A	G	4: 141,920,788	Y256H	probably benign	Het
Gfra1	C	T	19: 58,239,307	A395T	possibly damaging	Het
Gm10323	C	A	13: 66,854,510	C55F	probably benign	Het
Gm9573	T	C	17: 35,619,707		probably benign	Het
Greb1	T	C	12: 16,699,550	S1092G	probably damaging	Het
Grid1	A	T	14: 35,562,559	D753V	probably damaging	Het
Grin2b	A	G	6: 135,733,639	F970L	probably damaging	Het
Kcnma1	A	T	14: 23,373,207	N682K	probably benign	Het
Lat2	T	A	5: 134,605,944	D114V	probably damaging	Het
Mapk10	C	T	5: 103,038,682	D25N	probably benign	Het
Mroh7	C	T	4: 106,691,090	G1064R	probably damaging	Het
Olfr1089	A	T	2: 86,733,429	F61Y	possibly damaging	Het
Olfr1564	T	A	17: 33,216,278	H22L	probably benign	Het
Olfr467	T	A	7: 107,814,919	C112S	probably benign	Het
Olfr615	A	T	7: 103,560,857	I127F	probably damaging	Het
Psg27	T	A	7: 18,561,893	D209V	probably benign	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
Pzp	A	G	6: 128,525,264	S41P	possibly damaging	Het
Rab23	A	T	1: 33,738,295	K163N	possibly damaging	Het
Rilpl2	T	C	5: 124,477,835	D84G	probably damaging	Het
Sorl1	A	G	9: 41,969,781	I2148T	probably benign	Het
Tead1	A	G	7: 112,759,487	E2G	probably damaging	Het
Tigd4	A	G	3: 84,593,952	N59D	possibly damaging	Het
Tmprss15	T	A	16: 79,035,233	D345V	possibly damaging	Het
Togaram2	T	C	17: 71,709,597	S649P	probably benign	Het
Ucp2	T	C	7: 100,497,252	V95A	probably benign	Het
Usp17lb	T	C	7: 104,840,748	D323G	probably damaging	Het
Zfp677	A	T	17: 21,397,256	K192*	probably null	Het
Zmym2	T	A	14: 56,928,248	I676K	probably damaging	Het
Znrd1as	A	T	17: 36,965,160	R211S	possibly damaging	Het

Other mutations in Lcat

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02494:Lcat	APN	8	105941939	unclassified	probably benign
IGL02654:Lcat	APN	8	105939769	missense	possibly damaging	0.68
IGL02678:Lcat	APN	8	105941940	splice site	probably null
IGL02963:Lcat	APN	8	105939956	missense	probably damaging	0.99
IGL03304:Lcat	APN	8	105940063	missense	possibly damaging	0.94
R1754:Lcat	UTSW	8	105941814	frame shift	probably null
R1757:Lcat	UTSW	8	105941814	frame shift	probably null
R1824:Lcat	UTSW	8	105939888	missense	probably damaging	0.98
R1962:Lcat	UTSW	8	105941723	missense	probably damaging	0.98
R4091:Lcat	UTSW	8	105939906	missense	probably benign	0.09
R4172:Lcat	UTSW	8	105942427	missense	possibly damaging	0.56
R4921:Lcat	UTSW	8	105942442	missense	possibly damaging	0.92
R5487:Lcat	UTSW	8	105939664	missense	probably benign
R6552:Lcat	UTSW	8	105939679	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- CATGGGCAGCAAATGTACGG -3'
(R):5'- CTGTCCAACATAAAGCTGAAAGAGG -3'

Sequencing Primer
(F):5'- CAAATGTACGGGCTGCGACTG -3'
(R):5'- ACGACTTCCCCCTGGATG -3'

Posted On

2014-12-04