Incidental Mutation 'R2866:Atmin'
ID253260
Institutional Source Beutler Lab
Gene Symbol Atmin
Ensembl Gene ENSMUSG00000047388
Gene NameATM interactor
Synonymsgpg6, Asciz
MMRRC Submission 040455-MU
Accession Numbers

Ncbi RefSeq: NM_177700.4; MGI:2682328

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2866 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location116943393-116960445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116956373 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 257 (D257E)
Ref Sequence ENSEMBL: ENSMUSP00000104727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109099]
Predicted Effect probably benign
Transcript: ENSMUST00000109099
AA Change: D257E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104727
Gene: ENSMUSG00000047388
AA Change: D257E

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
low complexity region 46 62 N/A INTRINSIC
ZnF_C2H2 80 105 2.49e-1 SMART
ZnF_C2H2 127 156 7.11e0 SMART
ZnF_C2H2 161 181 4.5e1 SMART
ZnF_C2H2 187 210 1.06e2 SMART
low complexity region 289 304 N/A INTRINSIC
low complexity region 644 657 N/A INTRINSIC
low complexity region 722 738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype Strain: 4868762; 4881337
Lethality: E16-E19
PHENOTYPE: Mice homozygous for a knock-out allele exhibit fetal lethality, craniofacial defects, midbrain exencephaly, and premature senescence of mouse embryonic fibroblasts. Homozygotes for an ENU-induced mutation exhibit left-right patterning defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Best1 T C 19: 9,986,221 E532G probably benign Het
Cenpj T C 14: 56,552,180 H804R probably benign Het
Clec2g T C 6: 128,948,756 S43P probably benign Het
Col8a2 A G 4: 126,311,199 probably benign Het
Cpz T C 5: 35,502,361 K647E probably benign Het
Csmd2 T C 4: 128,414,392 probably null Het
Ctss A G 3: 95,545,406 K166R probably benign Het
Cyp2c23 T C 19: 44,005,446 R494G probably damaging Het
Cyp2c68 A G 19: 39,689,145 I467T probably damaging Het
Dcaf11 A T 14: 55,565,745 T299S possibly damaging Het
Dennd1b A G 1: 139,170,281 S762G possibly damaging Het
Epb42 C T 2: 121,025,921 A381T possibly damaging Het
Fhad1 A G 4: 141,920,788 Y256H probably benign Het
Gfra1 C T 19: 58,239,307 A395T possibly damaging Het
Gm10323 C A 13: 66,854,510 C55F probably benign Het
Gm9573 T C 17: 35,619,707 probably benign Het
Greb1 T C 12: 16,699,550 S1092G probably damaging Het
Grid1 A T 14: 35,562,559 D753V probably damaging Het
Grin2b A G 6: 135,733,639 F970L probably damaging Het
Kcnma1 A T 14: 23,373,207 N682K probably benign Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Lcat C T 8: 105,939,879 C337Y probably damaging Het
Mapk10 C T 5: 103,038,682 D25N probably benign Het
Mroh7 C T 4: 106,691,090 G1064R probably damaging Het
Olfr1089 A T 2: 86,733,429 F61Y possibly damaging Het
Olfr1564 T A 17: 33,216,278 H22L probably benign Het
Olfr467 T A 7: 107,814,919 C112S probably benign Het
Olfr615 A T 7: 103,560,857 I127F probably damaging Het
Psg27 T A 7: 18,561,893 D209V probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Pzp A G 6: 128,525,264 S41P possibly damaging Het
Rab23 A T 1: 33,738,295 K163N possibly damaging Het
Rilpl2 T C 5: 124,477,835 D84G probably damaging Het
Sorl1 A G 9: 41,969,781 I2148T probably benign Het
Tead1 A G 7: 112,759,487 E2G probably damaging Het
Tigd4 A G 3: 84,593,952 N59D possibly damaging Het
Tmprss15 T A 16: 79,035,233 D345V possibly damaging Het
Togaram2 T C 17: 71,709,597 S649P probably benign Het
Ucp2 T C 7: 100,497,252 V95A probably benign Het
Usp17lb T C 7: 104,840,748 D323G probably damaging Het
Zfp677 A T 17: 21,397,256 K192* probably null Het
Zmym2 T A 14: 56,928,248 I676K probably damaging Het
Znrd1as A T 17: 36,965,160 R211S possibly damaging Het
Other mutations in Atmin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Atmin APN 8 116956657 missense probably damaging 1.00
IGL02680:Atmin APN 8 116957497 missense probably damaging 1.00
IGL03355:Atmin APN 8 116957425 nonsense probably null
K3955:Atmin UTSW 8 116957036 nonsense probably null
P0038:Atmin UTSW 8 116957036 nonsense probably null
R1440:Atmin UTSW 8 116957376 missense probably damaging 0.98
R1498:Atmin UTSW 8 116954801 missense probably benign 0.21
R1515:Atmin UTSW 8 116954840 missense possibly damaging 0.87
R2094:Atmin UTSW 8 116957538 missense probably damaging 1.00
R2306:Atmin UTSW 8 116957650 missense probably benign 0.04
R2363:Atmin UTSW 8 116954914 critical splice donor site probably null
R3743:Atmin UTSW 8 116956573 missense probably benign 0.02
R3901:Atmin UTSW 8 116956297 missense probably benign 0.00
R3902:Atmin UTSW 8 116956297 missense probably benign 0.00
R4664:Atmin UTSW 8 116957959 missense probably damaging 1.00
R4665:Atmin UTSW 8 116957959 missense probably damaging 1.00
R4666:Atmin UTSW 8 116957959 missense probably damaging 1.00
R5441:Atmin UTSW 8 116957957 missense probably damaging 0.99
R5496:Atmin UTSW 8 116957172 missense probably benign 0.01
R6914:Atmin UTSW 8 116956713 missense probably benign 0.02
R6942:Atmin UTSW 8 116956713 missense probably benign 0.02
R6965:Atmin UTSW 8 116957038 missense probably damaging 1.00
V7732:Atmin UTSW 8 116956479 missense probably damaging 1.00
X0020:Atmin UTSW 8 116952982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTCTAGCTCCAAGGGTAC -3'
(R):5'- CTGTAGGCACAAAGACAGGC -3'

Sequencing Primer
(F):5'- GGTACCCATTTCAGCCCG -3'
(R):5'- CACGGGGGAAAACTGCATGAC -3'
Posted On2014-12-04