Incidental Mutation 'R2474:Adgrl4'
ID253261
Institutional Source Beutler Lab
Gene Symbol Adgrl4
Ensembl Gene ENSMUSG00000039167
Gene Nameadhesion G protein-coupled receptor L4
SynonymsEltd1, Etl, EGF-TM7 receptor, 1110033N21Rik
MMRRC Submission 040405-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2474 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location151437887-151545086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151542724 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 678 (T678A)
Ref Sequence ENSEMBL: ENSMUSP00000041939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046977]
Predicted Effect probably benign
Transcript: ENSMUST00000046977
AA Change: T678A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000041939
Gene: ENSMUSG00000039167
AA Change: T678A

DomainStartEndE-ValueType
EGF 21 57 9.13e0 SMART
EGF_CA 58 107 4.88e-9 SMART
EGF_CA 108 157 4.88e-9 SMART
Pfam:GAIN 182 390 6.8e-38 PFAM
GPS 414 467 1.25e-17 SMART
Pfam:7tm_2 473 709 2.5e-58 PFAM
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: For a targeted mutation, no significant differences were detected between homozygous mice and controls in a high-throughput screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb7 A T 7: 66,679,153 N46K probably damaging Het
Atxn7l2 A C 3: 108,203,977 S414R probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cxcl13 C T 5: 95,959,957 Q91* probably null Het
Dchs1 T C 7: 105,755,074 N2754D probably benign Het
Dchs1 A T 7: 105,772,838 V125E probably damaging Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
Greb1 T C 12: 16,714,953 N393S possibly damaging Het
Hfm1 A T 5: 106,872,416 V1048D possibly damaging Het
Ilvbl T C 10: 78,576,724 V93A probably damaging Het
Itpkb A G 1: 180,334,151 D614G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lgi3 G A 14: 70,533,249 probably null Het
Mpeg1 G A 19: 12,462,249 C357Y probably damaging Het
Nedd1 A G 10: 92,719,603 F7L probably damaging Het
Olfr1082 C A 2: 86,594,613 V72F probably benign Het
Olfr943 A G 9: 39,184,550 D121G probably damaging Het
Parp8 A T 13: 116,893,041 C510S possibly damaging Het
Phb T C 11: 95,671,422 F42L possibly damaging Het
Pik3r1 A T 13: 101,702,776 Y189* probably null Het
Rps5 T A 7: 12,926,561 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp3 T A 11: 69,674,097 N516Y probably damaging Het
Tfap2b A T 1: 19,214,375 H169L possibly damaging Het
Tmem260 A G 14: 48,496,324 D226G probably null Het
Ttc6 G T 12: 57,575,927 R37S probably benign Het
Vmn2r84 A T 10: 130,386,523 D609E possibly damaging Het
Vmn2r99 A T 17: 19,378,629 M192L probably benign Het
Zfp746 T C 6: 48,064,769 D341G probably damaging Het
Zfp941 A T 7: 140,811,471 H658Q probably damaging Het
Zw10 T A 9: 49,066,805 I351N probably damaging Het
Other mutations in Adgrl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Adgrl4 APN 3 151542841 missense probably damaging 1.00
IGL00694:Adgrl4 APN 3 151439396 splice site probably benign
IGL01143:Adgrl4 APN 3 151500229 splice site probably null
IGL01359:Adgrl4 APN 3 151543286 missense probably damaging 1.00
IGL01947:Adgrl4 APN 3 151510791 critical splice donor site probably null
IGL02149:Adgrl4 APN 3 151500354 missense possibly damaging 0.95
IGL02324:Adgrl4 APN 3 151497874 missense probably damaging 1.00
IGL02562:Adgrl4 APN 3 151439312 missense probably damaging 1.00
IGL02644:Adgrl4 APN 3 151492370 missense probably benign 0.00
trivial UTSW 3 151517610 missense probably benign 0.07
R0077:Adgrl4 UTSW 3 151517781 missense probably damaging 1.00
R0116:Adgrl4 UTSW 3 151517610 missense probably benign 0.07
R0331:Adgrl4 UTSW 3 151497940 missense probably benign 0.00
R0601:Adgrl4 UTSW 3 151498429 splice site probably benign
R0613:Adgrl4 UTSW 3 151543222 splice site probably benign
R1293:Adgrl4 UTSW 3 151507444 missense probably benign 0.00
R1463:Adgrl4 UTSW 3 151510596 missense probably damaging 0.98
R1697:Adgrl4 UTSW 3 151517611 missense probably damaging 1.00
R1731:Adgrl4 UTSW 3 151540986 missense possibly damaging 0.64
R1765:Adgrl4 UTSW 3 151543235 missense probably damaging 1.00
R1782:Adgrl4 UTSW 3 151542805 nonsense probably null
R1888:Adgrl4 UTSW 3 151439277 missense probably benign 0.11
R1888:Adgrl4 UTSW 3 151439277 missense probably benign 0.11
R1957:Adgrl4 UTSW 3 151510779 missense possibly damaging 0.94
R2128:Adgrl4 UTSW 3 151500201 missense probably benign 0.00
R2180:Adgrl4 UTSW 3 151500142 missense probably damaging 0.96
R2238:Adgrl4 UTSW 3 151500142 missense probably damaging 0.96
R2697:Adgrl4 UTSW 3 151510623 missense probably damaging 1.00
R3835:Adgrl4 UTSW 3 151510617 missense probably damaging 1.00
R4499:Adgrl4 UTSW 3 151510785 missense possibly damaging 0.81
R4640:Adgrl4 UTSW 3 151500310 unclassified probably benign
R4747:Adgrl4 UTSW 3 151507440 missense probably benign 0.01
R5428:Adgrl4 UTSW 3 151542686 missense probably damaging 1.00
R5510:Adgrl4 UTSW 3 151497830 missense possibly damaging 0.89
R5717:Adgrl4 UTSW 3 151492334 missense probably benign 0.01
R6106:Adgrl4 UTSW 3 151540985 missense possibly damaging 0.67
R6343:Adgrl4 UTSW 3 151517806 missense probably damaging 1.00
R6419:Adgrl4 UTSW 3 151439316 missense probably damaging 1.00
R6468:Adgrl4 UTSW 3 151492375 missense probably benign
R6636:Adgrl4 UTSW 3 151517773 nonsense probably null
R6637:Adgrl4 UTSW 3 151517773 nonsense probably null
R6687:Adgrl4 UTSW 3 151542755 missense probably benign 0.00
R6856:Adgrl4 UTSW 3 151500118 missense probably benign 0.00
R6887:Adgrl4 UTSW 3 151542733 missense possibly damaging 0.46
R7041:Adgrl4 UTSW 3 151439322 missense probably benign 0.00
R7527:Adgrl4 UTSW 3 151439250 missense not run
X0053:Adgrl4 UTSW 3 151497833 missense probably damaging 1.00
Z1088:Adgrl4 UTSW 3 151500175 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGTTGCATCAAACCACAAGC -3'
(R):5'- GTCACACTTCAAGGCAACAG -3'

Sequencing Primer
(F):5'- CCACAAGCCAGCTATGAGC -3'
(R):5'- GTCACACTTCAAGGCAACAGTTTTTC -3'
Posted On2014-12-04