Incidental Mutation 'R2474:Zfp746'
ID253267
Institutional Source Beutler Lab
Gene Symbol Zfp746
Ensembl Gene ENSMUSG00000057691
Gene Namezinc finger protein 746
Synonyms2810407L07Rik
MMRRC Submission 040405-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R2474 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48062395-48086593 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48064769 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 341 (D341G)
Ref Sequence ENSEMBL: ENSMUSP00000072868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073124] [ENSMUST00000203609]
Predicted Effect probably damaging
Transcript: ENSMUST00000073124
AA Change: D341G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072868
Gene: ENSMUSG00000057691
AA Change: D341G

DomainStartEndE-ValueType
Pfam:DUF3669 11 81 3.4e-12 PFAM
KRAB 107 156 1.37e-12 SMART
low complexity region 168 183 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
ZnF_C2H2 454 474 3.65e1 SMART
low complexity region 481 511 N/A INTRINSIC
ZnF_C2H2 517 539 1.92e-2 SMART
ZnF_C2H2 545 567 1.82e-3 SMART
ZnF_C2H2 573 595 1.72e-4 SMART
low complexity region 601 623 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000203033
AA Change: D124G
Predicted Effect possibly damaging
Transcript: ENSMUST00000203609
AA Change: D340G

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000145506
Gene: ENSMUSG00000057691
AA Change: D340G

DomainStartEndE-ValueType
Pfam:DUF3669 11 81 4.6e-9 PFAM
KRAB 107 156 5.7e-15 SMART
low complexity region 168 183 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
ZnF_C2H2 453 473 1.6e-1 SMART
low complexity region 480 510 N/A INTRINSIC
ZnF_C2H2 516 538 8e-5 SMART
ZnF_C2H2 544 566 7.8e-6 SMART
ZnF_C2H2 572 594 7.3e-7 SMART
low complexity region 600 622 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204771
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A G 3: 151,542,724 T678A probably benign Het
Asb7 A T 7: 66,679,153 N46K probably damaging Het
Atxn7l2 A C 3: 108,203,977 S414R probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cxcl13 C T 5: 95,959,957 Q91* probably null Het
Dchs1 T C 7: 105,755,074 N2754D probably benign Het
Dchs1 A T 7: 105,772,838 V125E probably damaging Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
Greb1 T C 12: 16,714,953 N393S possibly damaging Het
Hfm1 A T 5: 106,872,416 V1048D possibly damaging Het
Ilvbl T C 10: 78,576,724 V93A probably damaging Het
Itpkb A G 1: 180,334,151 D614G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lgi3 G A 14: 70,533,249 probably null Het
Mpeg1 G A 19: 12,462,249 C357Y probably damaging Het
Nedd1 A G 10: 92,719,603 F7L probably damaging Het
Olfr1082 C A 2: 86,594,613 V72F probably benign Het
Olfr943 A G 9: 39,184,550 D121G probably damaging Het
Parp8 A T 13: 116,893,041 C510S possibly damaging Het
Phb T C 11: 95,671,422 F42L possibly damaging Het
Pik3r1 A T 13: 101,702,776 Y189* probably null Het
Rps5 T A 7: 12,926,561 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp3 T A 11: 69,674,097 N516Y probably damaging Het
Tfap2b A T 1: 19,214,375 H169L possibly damaging Het
Tmem260 A G 14: 48,496,324 D226G probably null Het
Ttc6 G T 12: 57,575,927 R37S probably benign Het
Vmn2r84 A T 10: 130,386,523 D609E possibly damaging Het
Vmn2r99 A T 17: 19,378,629 M192L probably benign Het
Zfp941 A T 7: 140,811,471 H658Q probably damaging Het
Zw10 T A 9: 49,066,805 I351N probably damaging Het
Other mutations in Zfp746
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01993:Zfp746 APN 6 48082158 missense probably damaging 0.99
R0020:Zfp746 UTSW 6 48064707 missense probably benign 0.05
R0020:Zfp746 UTSW 6 48064707 missense probably benign 0.05
R0734:Zfp746 UTSW 6 48064899 missense probably damaging 0.97
R1109:Zfp746 UTSW 6 48064922 missense possibly damaging 0.94
R1656:Zfp746 UTSW 6 48064477 missense probably damaging 0.99
R1657:Zfp746 UTSW 6 48082174 missense possibly damaging 0.94
R4748:Zfp746 UTSW 6 48064556 missense probably benign 0.05
R5168:Zfp746 UTSW 6 48064395 missense possibly damaging 0.88
R5386:Zfp746 UTSW 6 48064176 missense possibly damaging 0.94
R5446:Zfp746 UTSW 6 48064173 missense probably damaging 0.97
R5560:Zfp746 UTSW 6 48082174 missense possibly damaging 0.94
R7251:Zfp746 UTSW 6 48064877 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTTGTCTGGAGATGAGAAAG -3'
(R):5'- GTCCAGAATGATCTCTGCCC -3'

Sequencing Primer
(F):5'- TTGTCTGGAGATGAGAAAGGGAGC -3'
(R):5'- CAGAATGATCTCTGCCCTACTC -3'
Posted On2014-12-04