Incidental Mutation 'R2866:Olfr1564'
ID253288
Institutional Source Beutler Lab
Gene Symbol Olfr1564
Ensembl Gene ENSMUSG00000096169
Gene Nameolfactory receptor 1564
SynonymsGm4461
MMRRC Submission 040455-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R2866 (G1)
Quality Score187
Status Not validated
Chromosome17
Chromosomal Location33211206-33221690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33216278 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 22 (H22L)
Ref Sequence ENSEMBL: ENSMUSP00000150573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112162] [ENSMUST00000208645] [ENSMUST00000213642] [ENSMUST00000213751] [ENSMUST00000215450]
Predicted Effect probably benign
Transcript: ENSMUST00000112162
AA Change: H25L

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127247
Gene: ENSMUSG00000096169
AA Change: H25L

DomainStartEndE-ValueType
Pfam:7tm_4 34 312 3.3e-53 PFAM
Pfam:7TM_GPCR_Srsx 38 263 1.5e-5 PFAM
Pfam:7tm_1 44 297 5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208645
AA Change: H22L

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000213642
AA Change: H22L

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000213751
AA Change: H22L

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000215450
AA Change: H22L

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin T A 8: 116,956,373 D257E probably benign Het
Best1 T C 19: 9,986,221 E532G probably benign Het
Cenpj T C 14: 56,552,180 H804R probably benign Het
Clec2g T C 6: 128,948,756 S43P probably benign Het
Col8a2 A G 4: 126,311,199 probably benign Het
Cpz T C 5: 35,502,361 K647E probably benign Het
Csmd2 T C 4: 128,414,392 probably null Het
Ctss A G 3: 95,545,406 K166R probably benign Het
Cyp2c23 T C 19: 44,005,446 R494G probably damaging Het
Cyp2c68 A G 19: 39,689,145 I467T probably damaging Het
Dcaf11 A T 14: 55,565,745 T299S possibly damaging Het
Dennd1b A G 1: 139,170,281 S762G possibly damaging Het
Epb42 C T 2: 121,025,921 A381T possibly damaging Het
Fhad1 A G 4: 141,920,788 Y256H probably benign Het
Gfra1 C T 19: 58,239,307 A395T possibly damaging Het
Gm10323 C A 13: 66,854,510 C55F probably benign Het
Gm9573 T C 17: 35,619,707 probably benign Het
Greb1 T C 12: 16,699,550 S1092G probably damaging Het
Grid1 A T 14: 35,562,559 D753V probably damaging Het
Grin2b A G 6: 135,733,639 F970L probably damaging Het
Kcnma1 A T 14: 23,373,207 N682K probably benign Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Lcat C T 8: 105,939,879 C337Y probably damaging Het
Mapk10 C T 5: 103,038,682 D25N probably benign Het
Mroh7 C T 4: 106,691,090 G1064R probably damaging Het
Olfr1089 A T 2: 86,733,429 F61Y possibly damaging Het
Olfr467 T A 7: 107,814,919 C112S probably benign Het
Olfr615 A T 7: 103,560,857 I127F probably damaging Het
Psg27 T A 7: 18,561,893 D209V probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Pzp A G 6: 128,525,264 S41P possibly damaging Het
Rab23 A T 1: 33,738,295 K163N possibly damaging Het
Rilpl2 T C 5: 124,477,835 D84G probably damaging Het
Sorl1 A G 9: 41,969,781 I2148T probably benign Het
Tead1 A G 7: 112,759,487 E2G probably damaging Het
Tigd4 A G 3: 84,593,952 N59D possibly damaging Het
Tmprss15 T A 16: 79,035,233 D345V possibly damaging Het
Togaram2 T C 17: 71,709,597 S649P probably benign Het
Ucp2 T C 7: 100,497,252 V95A probably benign Het
Usp17lb T C 7: 104,840,748 D323G probably damaging Het
Zfp677 A T 17: 21,397,256 K192* probably null Het
Zmym2 T A 14: 56,928,248 I676K probably damaging Het
Znrd1as A T 17: 36,965,160 R211S possibly damaging Het
Other mutations in Olfr1564
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Olfr1564 APN 17 33215973 missense probably benign 0.41
R0079:Olfr1564 UTSW 17 33216105 missense probably benign 0.14
R0939:Olfr1564 UTSW 17 33215661 missense possibly damaging 0.72
R1279:Olfr1564 UTSW 17 33216326 missense possibly damaging 0.59
R2167:Olfr1564 UTSW 17 33215568 missense probably damaging 0.97
R4738:Olfr1564 UTSW 17 33215810 missense probably benign 0.03
R4976:Olfr1564 UTSW 17 33215754 missense probably benign 0.35
R6452:Olfr1564 UTSW 17 33215945 missense probably benign 0.03
R6721:Olfr1564 UTSW 17 33215534 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAACATGCGTGGGATGATGG -3'
(R):5'- CTGAGAAAGTTAAAGAAGCCTCTC -3'

Sequencing Primer
(F):5'- TGATGGCAAAGGTGTAGAAAATCTC -3'
(R):5'- GAAGCCTCTCAGATATCCTTCTAAG -3'
Posted On2014-12-04