Incidental Mutation 'R2866:Znrd1as'
ID253292
Institutional Source Beutler Lab
Gene Symbol Znrd1as
Ensembl Gene ENSMUSG00000036214
Gene Namezinc ribbon domain containing 1, antisense
Synonyms1700022C21Rik
MMRRC Submission 040455-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R2866 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location36958592-36965625 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36965160 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 211 (R211S)
Ref Sequence ENSEMBL: ENSMUSP00000147556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040177] [ENSMUST00000173814] [ENSMUST00000209623]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040177
AA Change: R141S

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048695
Gene: ENSMUSG00000036214
AA Change: R141S

DomainStartEndE-ValueType
low complexity region 98 115 N/A INTRINSIC
coiled coil region 163 195 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172672
Predicted Effect possibly damaging
Transcript: ENSMUST00000173814
AA Change: R62S

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134016
Gene: ENSMUSG00000036214
AA Change: R62S

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
coiled coil region 84 116 N/A INTRINSIC
low complexity region 145 157 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185085
Predicted Effect possibly damaging
Transcript: ENSMUST00000209623
AA Change: R211S

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin T A 8: 116,956,373 D257E probably benign Het
Best1 T C 19: 9,986,221 E532G probably benign Het
Cenpj T C 14: 56,552,180 H804R probably benign Het
Clec2g T C 6: 128,948,756 S43P probably benign Het
Col8a2 A G 4: 126,311,199 probably benign Het
Cpz T C 5: 35,502,361 K647E probably benign Het
Csmd2 T C 4: 128,414,392 probably null Het
Ctss A G 3: 95,545,406 K166R probably benign Het
Cyp2c23 T C 19: 44,005,446 R494G probably damaging Het
Cyp2c68 A G 19: 39,689,145 I467T probably damaging Het
Dcaf11 A T 14: 55,565,745 T299S possibly damaging Het
Dennd1b A G 1: 139,170,281 S762G possibly damaging Het
Epb42 C T 2: 121,025,921 A381T possibly damaging Het
Fhad1 A G 4: 141,920,788 Y256H probably benign Het
Gfra1 C T 19: 58,239,307 A395T possibly damaging Het
Gm10323 C A 13: 66,854,510 C55F probably benign Het
Gm9573 T C 17: 35,619,707 probably benign Het
Greb1 T C 12: 16,699,550 S1092G probably damaging Het
Grid1 A T 14: 35,562,559 D753V probably damaging Het
Grin2b A G 6: 135,733,639 F970L probably damaging Het
Kcnma1 A T 14: 23,373,207 N682K probably benign Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Lcat C T 8: 105,939,879 C337Y probably damaging Het
Mapk10 C T 5: 103,038,682 D25N probably benign Het
Mroh7 C T 4: 106,691,090 G1064R probably damaging Het
Olfr1089 A T 2: 86,733,429 F61Y possibly damaging Het
Olfr1564 T A 17: 33,216,278 H22L probably benign Het
Olfr467 T A 7: 107,814,919 C112S probably benign Het
Olfr615 A T 7: 103,560,857 I127F probably damaging Het
Psg27 T A 7: 18,561,893 D209V probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Pzp A G 6: 128,525,264 S41P possibly damaging Het
Rab23 A T 1: 33,738,295 K163N possibly damaging Het
Rilpl2 T C 5: 124,477,835 D84G probably damaging Het
Sorl1 A G 9: 41,969,781 I2148T probably benign Het
Tead1 A G 7: 112,759,487 E2G probably damaging Het
Tigd4 A G 3: 84,593,952 N59D possibly damaging Het
Tmprss15 T A 16: 79,035,233 D345V possibly damaging Het
Togaram2 T C 17: 71,709,597 S649P probably benign Het
Ucp2 T C 7: 100,497,252 V95A probably benign Het
Usp17lb T C 7: 104,840,748 D323G probably damaging Het
Zfp677 A T 17: 21,397,256 K192* probably null Het
Zmym2 T A 14: 56,928,248 I676K probably damaging Het
Other mutations in Znrd1as
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Znrd1as APN 17 36964921 missense probably damaging 0.99
R0347:Znrd1as UTSW 17 36965315 missense probably damaging 1.00
R0789:Znrd1as UTSW 17 36964960 missense probably damaging 1.00
R0993:Znrd1as UTSW 17 36965047 small deletion probably benign
R2110:Znrd1as UTSW 17 36965444 missense possibly damaging 0.47
R4224:Znrd1as UTSW 17 36958725 utr 5 prime probably benign
R4746:Znrd1as UTSW 17 36964873 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGACTACTGGCTTGCAAAAG -3'
(R):5'- AAGTTCCCTCCCTCGAATCATG -3'

Sequencing Primer
(F):5'- GCTTGCAAAAGCAGAGTCG -3'
(R):5'- ATCATGCGCTCCCGGTGATC -3'
Posted On2014-12-04