Incidental Mutation 'R2866:Best1'
ID253295
Institutional Source Beutler Lab
Gene Symbol Best1
Ensembl Gene ENSMUSG00000037418
Gene Namebestrophin 1
Synonymsbest macular dystrophy, mBest1, Vmd2
MMRRC Submission 040455-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2866 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location9985174-10001633 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9986221 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 532 (E532G)
Ref Sequence ENSEMBL: ENSMUSP00000113053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025563] [ENSMUST00000117346]
Predicted Effect probably benign
Transcript: ENSMUST00000025563
SMART Domains Protein: ENSMUSP00000025563
Gene: ENSMUSG00000024661

DomainStartEndE-ValueType
Pfam:Ferritin 18 159 1.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117346
AA Change: E532G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113053
Gene: ENSMUSG00000037418
AA Change: E532G

DomainStartEndE-ValueType
Pfam:Bestrophin 8 316 8.5e-111 PFAM
low complexity region 476 488 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144273
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bestrophin gene family. This small gene family is characterized by proteins with a highly conserved N-terminus with four to six transmembrane domains. Bestrophins may form chloride ion channels or may regulate voltage-gated L-type calcium-ion channels. Bestrophins are generally believed to form calcium-activated chloride-ion channels in epithelial cells but they have also been shown to be highly permeable to bicarbonate ion transport in retinal tissue. Mutations in this gene are responsible for juvenile-onset vitelliform macular dystrophy (VMD2), also known as Best macular dystrophy, in addition to adult-onset vitelliform macular dystrophy (AVMD) and other retinopathies. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygous null mutations of this gene generally result in abnormal retinal pigment epithelium morphology and/or altered eye electrophysiology. Homozygotes for a null allele show male subfertility associated with abnormal sperm morphology and reduced motility in the absence of retinal pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atmin T A 8: 116,956,373 D257E probably benign Het
Cenpj T C 14: 56,552,180 H804R probably benign Het
Clec2g T C 6: 128,948,756 S43P probably benign Het
Col8a2 A G 4: 126,311,199 probably benign Het
Cpz T C 5: 35,502,361 K647E probably benign Het
Csmd2 T C 4: 128,414,392 probably null Het
Ctss A G 3: 95,545,406 K166R probably benign Het
Cyp2c23 T C 19: 44,005,446 R494G probably damaging Het
Cyp2c68 A G 19: 39,689,145 I467T probably damaging Het
Dcaf11 A T 14: 55,565,745 T299S possibly damaging Het
Dennd1b A G 1: 139,170,281 S762G possibly damaging Het
Epb42 C T 2: 121,025,921 A381T possibly damaging Het
Fhad1 A G 4: 141,920,788 Y256H probably benign Het
Gfra1 C T 19: 58,239,307 A395T possibly damaging Het
Gm10323 C A 13: 66,854,510 C55F probably benign Het
Gm9573 T C 17: 35,619,707 probably benign Het
Greb1 T C 12: 16,699,550 S1092G probably damaging Het
Grid1 A T 14: 35,562,559 D753V probably damaging Het
Grin2b A G 6: 135,733,639 F970L probably damaging Het
Kcnma1 A T 14: 23,373,207 N682K probably benign Het
Lat2 T A 5: 134,605,944 D114V probably damaging Het
Lcat C T 8: 105,939,879 C337Y probably damaging Het
Mapk10 C T 5: 103,038,682 D25N probably benign Het
Mroh7 C T 4: 106,691,090 G1064R probably damaging Het
Olfr1089 A T 2: 86,733,429 F61Y possibly damaging Het
Olfr1564 T A 17: 33,216,278 H22L probably benign Het
Olfr467 T A 7: 107,814,919 C112S probably benign Het
Olfr615 A T 7: 103,560,857 I127F probably damaging Het
Psg27 T A 7: 18,561,893 D209V probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Pzp A G 6: 128,525,264 S41P possibly damaging Het
Rab23 A T 1: 33,738,295 K163N possibly damaging Het
Rilpl2 T C 5: 124,477,835 D84G probably damaging Het
Sorl1 A G 9: 41,969,781 I2148T probably benign Het
Tead1 A G 7: 112,759,487 E2G probably damaging Het
Tigd4 A G 3: 84,593,952 N59D possibly damaging Het
Tmprss15 T A 16: 79,035,233 D345V possibly damaging Het
Togaram2 T C 17: 71,709,597 S649P probably benign Het
Ucp2 T C 7: 100,497,252 V95A probably benign Het
Usp17lb T C 7: 104,840,748 D323G probably damaging Het
Zfp677 A T 17: 21,397,256 K192* probably null Het
Zmym2 T A 14: 56,928,248 I676K probably damaging Het
Znrd1as A T 17: 36,965,160 R211S possibly damaging Het
Other mutations in Best1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Best1 APN 19 9986735 missense probably benign 0.22
IGL02129:Best1 APN 19 9992921 missense probably benign
IGL02310:Best1 APN 19 9989152 missense probably benign 0.00
IGL02470:Best1 APN 19 9992976 missense probably benign 0.43
IGL02505:Best1 APN 19 9989150 missense probably damaging 1.00
R0366:Best1 UTSW 19 9992053 splice site probably null
R1476:Best1 UTSW 19 9990489 nonsense probably null
R1674:Best1 UTSW 19 9993226 critical splice donor site probably null
R2091:Best1 UTSW 19 9992079 missense probably benign 0.27
R2516:Best1 UTSW 19 9993311 nonsense probably null
R4693:Best1 UTSW 19 9997135 missense probably damaging 1.00
R4851:Best1 UTSW 19 9991698 missense probably damaging 1.00
R4895:Best1 UTSW 19 9992771 missense probably benign 0.00
R5633:Best1 UTSW 19 9992103 missense probably benign 0.29
R5700:Best1 UTSW 19 9997199 unclassified probably benign
R5837:Best1 UTSW 19 9989119 splice site probably null
R6893:Best1 UTSW 19 9997082 missense probably damaging 1.00
X0065:Best1 UTSW 19 9986975 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGGCCTCTATCACAGGGTTC -3'
(R):5'- CCCATGACTTCTGAGACCAAG -3'

Sequencing Primer
(F):5'- CTATCACAGGGTTCTTTCCTAGGTAG -3'
(R):5'- AAACACTTGTGAGCTGCCTG -3'
Posted On2014-12-04