Incidental Mutation 'R2474:Vmn2r99'
ID253308
Institutional Source Beutler Lab
Gene Symbol Vmn2r99
Ensembl Gene ENSMUSG00000090304
Gene Namevomeronasal 2, receptor 99
SynonymsEG665376
MMRRC Submission 040405-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R2474 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location19361949-19401098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19378629 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 192 (M192L)
Ref Sequence ENSEMBL: ENSMUSP00000156067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176107] [ENSMUST00000231989]
Predicted Effect probably benign
Transcript: ENSMUST00000176107
AA Change: M192L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135236
Gene: ENSMUSG00000090304
AA Change: M192L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 81 448 5.7e-33 PFAM
Pfam:NCD3G 508 561 1.8e-21 PFAM
Pfam:7tm_3 593 829 4.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231989
AA Change: M192L

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.1296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 A G 3: 151,542,724 T678A probably benign Het
Asb7 A T 7: 66,679,153 N46K probably damaging Het
Atxn7l2 A C 3: 108,203,977 S414R probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cxcl13 C T 5: 95,959,957 Q91* probably null Het
Dchs1 T C 7: 105,755,074 N2754D probably benign Het
Dchs1 A T 7: 105,772,838 V125E probably damaging Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
Greb1 T C 12: 16,714,953 N393S possibly damaging Het
Hfm1 A T 5: 106,872,416 V1048D possibly damaging Het
Ilvbl T C 10: 78,576,724 V93A probably damaging Het
Itpkb A G 1: 180,334,151 D614G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lgi3 G A 14: 70,533,249 probably null Het
Mpeg1 G A 19: 12,462,249 C357Y probably damaging Het
Nedd1 A G 10: 92,719,603 F7L probably damaging Het
Olfr1082 C A 2: 86,594,613 V72F probably benign Het
Olfr943 A G 9: 39,184,550 D121G probably damaging Het
Parp8 A T 13: 116,893,041 C510S possibly damaging Het
Phb T C 11: 95,671,422 F42L possibly damaging Het
Pik3r1 A T 13: 101,702,776 Y189* probably null Het
Rps5 T A 7: 12,926,561 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp3 T A 11: 69,674,097 N516Y probably damaging Het
Tfap2b A T 1: 19,214,375 H169L possibly damaging Het
Tmem260 A G 14: 48,496,324 D226G probably null Het
Ttc6 G T 12: 57,575,927 R37S probably benign Het
Vmn2r84 A T 10: 130,386,523 D609E possibly damaging Het
Zfp746 T C 6: 48,064,769 D341G probably damaging Het
Zfp941 A T 7: 140,811,471 H658Q probably damaging Het
Zw10 T A 9: 49,066,805 I351N probably damaging Het
Other mutations in Vmn2r99
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Vmn2r99 APN 17 19378854 missense probably benign 0.01
IGL01113:Vmn2r99 APN 17 19394256 missense probably benign 0.20
IGL01138:Vmn2r99 APN 17 19382623 missense probably damaging 0.97
IGL01646:Vmn2r99 APN 17 19393658 splice site probably benign
IGL01769:Vmn2r99 APN 17 19380115 missense probably damaging 1.00
IGL02112:Vmn2r99 APN 17 19380232 missense probably null 0.99
IGL02891:Vmn2r99 APN 17 19378690 nonsense probably null
IGL03132:Vmn2r99 APN 17 19378223 nonsense probably null
FR4548:Vmn2r99 UTSW 17 19394285 missense probably damaging 0.97
FR4976:Vmn2r99 UTSW 17 19394285 missense probably damaging 0.97
PIT4382001:Vmn2r99 UTSW 17 19394343 missense probably damaging 1.00
R0196:Vmn2r99 UTSW 17 19394573 missense probably benign 0.00
R0720:Vmn2r99 UTSW 17 19379043 missense probably benign 0.00
R1501:Vmn2r99 UTSW 17 19362259 missense possibly damaging 0.93
R1519:Vmn2r99 UTSW 17 19380060 missense probably benign 0.00
R1670:Vmn2r99 UTSW 17 19362252 missense probably benign 0.37
R1682:Vmn2r99 UTSW 17 19377945 missense probably damaging 0.97
R1873:Vmn2r99 UTSW 17 19362153 missense probably benign 0.25
R1967:Vmn2r99 UTSW 17 19378815 missense probably benign 0.01
R2101:Vmn2r99 UTSW 17 19377991 missense probably damaging 1.00
R2519:Vmn2r99 UTSW 17 19378708 missense probably damaging 0.99
R3911:Vmn2r99 UTSW 17 19394373 missense possibly damaging 0.92
R3947:Vmn2r99 UTSW 17 19378990 missense probably benign 0.40
R3949:Vmn2r99 UTSW 17 19378990 missense probably benign 0.40
R4016:Vmn2r99 UTSW 17 19378570 missense possibly damaging 0.86
R4413:Vmn2r99 UTSW 17 19379260 missense probably damaging 1.00
R4594:Vmn2r99 UTSW 17 19393662 missense probably damaging 1.00
R4999:Vmn2r99 UTSW 17 19362135 start codon destroyed probably null 0.96
R5206:Vmn2r99 UTSW 17 19378606 missense probably benign 0.40
R5362:Vmn2r99 UTSW 17 19379339 missense probably benign 0.00
R5377:Vmn2r99 UTSW 17 19379269 missense probably damaging 1.00
R5455:Vmn2r99 UTSW 17 19394146 nonsense probably null
R6021:Vmn2r99 UTSW 17 19377948 missense probably damaging 1.00
R6059:Vmn2r99 UTSW 17 19378980 missense probably benign 0.00
R6214:Vmn2r99 UTSW 17 19382558 missense probably benign 0.19
R6215:Vmn2r99 UTSW 17 19382558 missense probably benign 0.19
R6313:Vmn2r99 UTSW 17 19382605 missense probably damaging 1.00
R6646:Vmn2r99 UTSW 17 19380031 missense probably damaging 1.00
R6810:Vmn2r99 UTSW 17 19380034 missense probably benign 0.20
R6885:Vmn2r99 UTSW 17 19380195 missense possibly damaging 0.52
R6991:Vmn2r99 UTSW 17 19378110 missense probably benign 0.03
R7060:Vmn2r99 UTSW 17 19394564 nonsense probably null
R7090:Vmn2r99 UTSW 17 19393710 missense possibly damaging 0.83
R7094:Vmn2r99 UTSW 17 19379311 missense probably benign 0.00
R7449:Vmn2r99 UTSW 17 19379145 missense probably benign 0.01
Z1088:Vmn2r99 UTSW 17 19379301 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GTCCTTGAAACTTAGAGGCCTTAC -3'
(R):5'- ATATGAAGTCCATGTGGCGG -3'

Sequencing Primer
(F):5'- ACTTAGAGGCCTTACAAAATTTTCTC -3'
(R):5'- CGGGGGTCATTTTTACAAAAGC -3'
Posted On2014-12-04