Incidental Mutation 'R0313:Abcg2'
ID25331
Institutional Source Beutler Lab
Gene Symbol Abcg2
Ensembl Gene ENSMUSG00000029802
Gene NameATP binding cassette subfamily G member 2 (Junior blood group)
SynonymsBcrp
MMRRC Submission 038523-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0313 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location58584523-58695676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58672097 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 309 (E309G)
Ref Sequence ENSEMBL: ENSMUSP00000138608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031822] [ENSMUST00000114294] [ENSMUST00000143752] [ENSMUST00000203146]
Predicted Effect probably benign
Transcript: ENSMUST00000031822
AA Change: E309G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031822
Gene: ENSMUSG00000029802
AA Change: E309G

DomainStartEndE-ValueType
AAA 71 269 9.08e-6 SMART
Pfam:ABC2_membrane 375 586 5.4e-42 PFAM
transmembrane domain 631 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114294
AA Change: E309G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109933
Gene: ENSMUSG00000029802
AA Change: E309G

DomainStartEndE-ValueType
AAA 71 269 9.08e-6 SMART
Pfam:ABC2_membrane 375 586 1.2e-40 PFAM
transmembrane domain 631 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143752
AA Change: E309G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138608
Gene: ENSMUSG00000029802
AA Change: E309G

DomainStartEndE-ValueType
AAA 71 269 9.08e-6 SMART
Pfam:ABC2_membrane 375 573 7.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145685
Predicted Effect probably benign
Transcript: ENSMUST00000203146
SMART Domains Protein: ENSMUSP00000145435
Gene: ENSMUSG00000029802

DomainStartEndE-ValueType
SCOP:d1jj7a_ 33 129 7e-8 SMART
Blast:AAA 71 125 3e-32 BLAST
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.9%
  • 20x: 88.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is included in the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. Alternatively referred to as a breast cancer resistance protein, the human protein functions as a xenobiotic transporter which may play a major role in multi-drug resistance. This protein likely serves as a cellular defense mechanism in response to mitoxantrone and anthracycline exposure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit extreme sensitivity to the dietary chlorophyll-catabolite pheophorbide a, resulting in severe phototoxic skin lesions upon light exposure. Mutants show a novel form of protoporphyria, associated with a 10-fold increase in erythrocyte levels of protoporphyrin IX. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A G 4: 58,811,892 I1411T probably benign Het
Ankmy1 C T 1: 92,886,221 G412D probably damaging Het
Cc2d1a G A 8: 84,136,969 T542I probably benign Het
Cldn18 T C 9: 99,698,914 I94V probably benign Het
Cobll1 G A 2: 65,095,744 R1195* probably null Het
Dnah7b A G 1: 46,207,643 T1660A probably damaging Het
Dzip3 G T 16: 48,937,061 Q870K probably damaging Het
Ebf4 T C 2: 130,306,787 probably benign Het
Esyt2 T C 12: 116,347,808 L439P probably damaging Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Haspin A G 11: 73,136,298 V655A probably damaging Het
Kmt2c T C 5: 25,344,930 E1351G probably damaging Het
Lama2 C A 10: 26,993,398 probably null Het
Lcp1 A G 14: 75,199,433 E73G probably damaging Het
Ltv1 C T 10: 13,182,860 probably null Het
Mcmdc2 A G 1: 9,932,141 Y529C probably damaging Het
Myo3b T A 2: 70,348,959 Y1172* probably null Het
Ncf1 T C 5: 134,229,567 M1V probably null Het
Olfr1297 C T 2: 111,621,600 S158N possibly damaging Het
Olfr250 T C 9: 38,368,304 S243P probably damaging Het
Olfr765 A G 10: 129,046,826 V79A possibly damaging Het
Pcif1 A T 2: 164,884,419 H80L probably damaging Het
Pclo T C 5: 14,678,873 probably benign Het
Polr2a T C 11: 69,735,080 Y1710C unknown Het
Ppp1r37 G A 7: 19,533,998 T324I probably damaging Het
Prmt1 T C 7: 44,978,748 D176G probably benign Het
Scn5a T C 9: 119,534,571 D501G probably damaging Het
Ska2 A G 11: 87,117,814 I89M possibly damaging Het
Slc39a7 G A 17: 34,029,544 A375V probably damaging Het
Ssrp1 T A 2: 85,041,554 I374N probably damaging Het
Stox2 C T 8: 47,192,134 G828R probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Uqcrc1 C A 9: 108,948,574 R114S possibly damaging Het
Usp38 A T 8: 80,984,442 L988* probably null Het
Vmn2r5 T A 3: 64,503,827 H440L probably benign Het
Wdr12 A T 1: 60,082,579 I271N possibly damaging Het
Xylt2 C T 11: 94,669,894 probably benign Het
Other mutations in Abcg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01489:Abcg2 APN 6 58685823 critical splice donor site probably null
IGL01654:Abcg2 APN 6 58683321 critical splice donor site probably null
IGL02646:Abcg2 APN 6 58685696 missense probably benign 0.01
IGL03342:Abcg2 APN 6 58665135 missense probably damaging 1.00
PIT4519001:Abcg2 UTSW 6 58674807 missense probably damaging 0.99
R0092:Abcg2 UTSW 6 58685777 missense probably benign 0.14
R0742:Abcg2 UTSW 6 58678326 missense probably benign 0.00
R1165:Abcg2 UTSW 6 58678300 missense probably benign 0.21
R1302:Abcg2 UTSW 6 58685817 missense probably damaging 1.00
R1476:Abcg2 UTSW 6 58678337 missense probably benign 0.06
R1523:Abcg2 UTSW 6 58685694 missense possibly damaging 0.96
R2056:Abcg2 UTSW 6 58690540 missense probably benign 0.20
R2057:Abcg2 UTSW 6 58690540 missense probably benign 0.20
R2153:Abcg2 UTSW 6 58684322 splice site probably null
R5636:Abcg2 UTSW 6 58672056 missense probably damaging 0.98
R5723:Abcg2 UTSW 6 58678351 nonsense probably null
R5972:Abcg2 UTSW 6 58672085 missense probably benign 0.00
R6319:Abcg2 UTSW 6 58674738 missense probably benign 0.03
R6896:Abcg2 UTSW 6 58683313 missense probably damaging 1.00
R7136:Abcg2 UTSW 6 58684340 missense possibly damaging 0.67
R7387:Abcg2 UTSW 6 58689624 missense possibly damaging 0.67
X0028:Abcg2 UTSW 6 58678276 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAGTCAGAGCGCACAGGACA -3'
(R):5'- ACACTCTCAGCACTTACAGAAAACAGTATCTA -3'

Sequencing Primer
(F):5'- CGCACAGGACAGTTAGTGATTTC -3'
(R):5'- TCATTATGCAGTCCTGGCTG -3'
Posted On2013-04-16