Incidental Mutation 'R2512:Lgi2'
ID253414
Institutional Source Beutler Lab
Gene Symbol Lgi2
Ensembl Gene ENSMUSG00000039252
Gene Nameleucine-rich repeat LGI family, member 2
Synonyms
MMRRC Submission 040418-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R2512 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location52533517-52566462 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 52537965 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 543 (*543R)
Ref Sequence ENSEMBL: ENSMUSP00000143707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039750] [ENSMUST00000199942]
Predicted Effect probably null
Transcript: ENSMUST00000039750
AA Change: *551R
SMART Domains Protein: ENSMUSP00000040436
Gene: ENSMUSG00000039252
AA Change: *551R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:LRRNT 32 62 9e-15 BLAST
LRR_TYP 81 104 7.26e-3 SMART
LRR_TYP 105 128 4.72e-2 SMART
LRRCT 140 189 4.49e-4 SMART
Pfam:EPTP 224 265 3.9e-12 PFAM
Pfam:EPTP 270 311 2e-13 PFAM
Pfam:EPTP 316 362 2.1e-16 PFAM
Pfam:EPTP 365 407 2.3e-9 PFAM
Pfam:EPTP 412 454 4.8e-12 PFAM
Pfam:EPTP 457 498 2.7e-14 PFAM
low complexity region 499 509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198876
Predicted Effect probably null
Transcript: ENSMUST00000199942
AA Change: *543R
SMART Domains Protein: ENSMUSP00000143707
Gene: ENSMUSG00000039252
AA Change: *543R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:LRRNT 32 62 7e-15 BLAST
LRR_TYP 81 104 7.26e-3 SMART
LRR_TYP 105 128 4.72e-2 SMART
LRR_TYP 129 152 5.99e-4 SMART
LRRCT 164 213 4.49e-4 SMART
Pfam:EPTP 216 257 5.6e-12 PFAM
Pfam:EPTP 262 303 2.8e-13 PFAM
Pfam:EPTP 308 354 3e-16 PFAM
Pfam:EPTP 357 399 3.3e-9 PFAM
Pfam:EPTP 404 446 6.8e-12 PFAM
Pfam:EPTP 449 490 3.8e-14 PFAM
low complexity region 491 501 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,726 T60A probably benign Het
2700049A03Rik A G 12: 71,173,171 T831A possibly damaging Het
Actg2 T A 6: 83,526,847 I72F probably damaging Het
Add1 A G 5: 34,616,686 T80A probably benign Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Aplp2 C T 9: 31,167,677 R325H probably damaging Het
Aptx G A 4: 40,694,917 P140S probably benign Het
C87499 T G 4: 88,628,958 M246L probably damaging Het
Carm1 A G 9: 21,575,412 probably null Het
Carmil2 A T 8: 105,697,393 I1293F probably benign Het
Cdh8 T C 8: 99,400,863 T39A probably benign Het
Col15a1 T A 4: 47,245,868 N206K possibly damaging Het
Copg2 C T 6: 30,896,656 probably null Het
Ctr9 T G 7: 111,046,871 I690S probably damaging Het
Dcaf8 T G 1: 172,189,035 I463S possibly damaging Het
Dcp1b G T 6: 119,206,512 A187S possibly damaging Het
Ddo T A 10: 40,632,939 D58E possibly damaging Het
Dkkl1 G T 7: 45,207,733 R137S probably damaging Het
Dxo A G 17: 34,837,742 N115S probably benign Het
Ep400 A T 5: 110,708,915 probably benign Het
F11 A G 8: 45,261,061 V7A probably benign Het
Fermt1 G T 2: 132,939,518 probably null Het
Fign A T 2: 63,979,799 F376I probably benign Het
Flg2 G T 3: 93,201,775 G370V probably damaging Het
Fndc3a A T 14: 72,556,275 D953E probably benign Het
Fsip2 A T 2: 82,978,167 H1610L probably benign Het
Gfra3 T C 18: 34,704,511 N145D probably benign Het
Inpp4b G T 8: 82,010,550 W525C probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lyn A G 4: 3,745,542 T114A probably benign Het
Lynx1 A G 15: 74,751,320 Y88H probably damaging Het
Map4 C A 9: 110,034,702 P332T possibly damaging Het
Mapk8ip3 A T 17: 24,914,703 C250* probably null Het
Metap1d A G 2: 71,522,610 H261R probably damaging Het
Mfrp T C 9: 44,102,538 V115A probably benign Het
Mtbp A G 15: 55,577,536 Y373C probably damaging Het
Mtor C A 4: 148,530,491 R1628S possibly damaging Het
Muc5b A G 7: 141,859,076 N1920D unknown Het
Myo1d T A 11: 80,779,717 M26L probably benign Het
Neb A C 2: 52,210,831 D643E probably damaging Het
Nme1 A G 11: 93,960,687 F108L possibly damaging Het
Olfr458 A G 6: 42,460,273 S249P probably damaging Het
Olfr893 G T 9: 38,209,374 C54F probably damaging Het
Pan2 T A 10: 128,304,457 D82E probably damaging Het
Pclo A G 5: 14,712,598 D3695G unknown Het
Pcnx4 A T 12: 72,556,799 probably null Het
Plg A G 17: 12,403,229 T479A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ptgis T C 2: 167,207,276 D372G probably damaging Het
Ranbp3l A G 15: 8,968,465 T14A probably benign Het
Rcc1l A T 5: 134,166,669 V230D probably damaging Het
Reln T C 5: 21,979,690 D1609G possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr1 G A 7: 29,103,542 L696F possibly damaging Het
Sacs T A 14: 61,203,080 D858E probably benign Het
Sec16a C T 2: 26,439,025 V993I probably benign Het
Skint5 T A 4: 113,630,419 I901F unknown Het
Slc17a3 A T 13: 23,846,247 I114F probably benign Het
Slc17a7 T A 7: 45,168,864 L71Q probably damaging Het
Slc43a2 T C 11: 75,570,577 S452P probably damaging Het
Smarca4 A G 9: 21,635,698 N173S possibly damaging Het
Tbc1d21 T C 9: 58,362,912 Y161C probably damaging Het
Tpsab1 C A 17: 25,345,107 C94F probably damaging Het
Ubr5 G A 15: 38,002,319 P1496L probably damaging Het
Unc80 G T 1: 66,671,608 A2679S possibly damaging Het
Vdac1 T A 11: 52,384,077 V184E probably damaging Het
Vmn2r24 T A 6: 123,787,026 S287R probably benign Het
Vmn2r91 T C 17: 18,135,786 F572L probably benign Het
Vps13b G A 15: 35,884,555 E3125K probably benign Het
Ythdf3 A G 3: 16,204,895 N406S possibly damaging Het
Zfp708 T C 13: 67,071,187 K158E probably damaging Het
Other mutations in Lgi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Lgi2 APN 5 52538121 missense probably benign
IGL01310:Lgi2 APN 5 52554465 missense probably benign 0.44
IGL02086:Lgi2 APN 5 52565957 missense probably damaging 0.96
IGL03091:Lgi2 APN 5 52563965 critical splice donor site probably null
IGL03367:Lgi2 APN 5 52562160 missense probably damaging 1.00
IGL03388:Lgi2 APN 5 52538477 missense probably damaging 1.00
R0388:Lgi2 UTSW 5 52554549 missense probably damaging 0.99
R0602:Lgi2 UTSW 5 52554423 missense probably damaging 0.98
R0633:Lgi2 UTSW 5 52554460 missense probably damaging 0.97
R1616:Lgi2 UTSW 5 52546638 missense probably benign 0.00
R1916:Lgi2 UTSW 5 52546632 missense probably benign
R2072:Lgi2 UTSW 5 52538505 missense probably damaging 1.00
R4614:Lgi2 UTSW 5 52538433 missense probably damaging 0.99
R4855:Lgi2 UTSW 5 52538507 missense probably damaging 1.00
R5092:Lgi2 UTSW 5 52538087 missense probably damaging 1.00
R5181:Lgi2 UTSW 5 52554450 missense probably damaging 1.00
R5311:Lgi2 UTSW 5 52554485 missense probably damaging 0.99
R6074:Lgi2 UTSW 5 52546642 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAGGCCTCTCATGCAATCAGC -3'
(R):5'- TCTCACAGATCTACCAGTGGG -3'

Sequencing Primer
(F):5'- GCAATCCCTGGTTAAAATGTGAATCC -3'
(R):5'- CTCACAGATCTACCAGTGGGATAAAG -3'
Posted On2014-12-04