Incidental Mutation 'R2512:Aplp2'
ID253462
Institutional Source Beutler Lab
Gene Symbol Aplp2
Ensembl Gene ENSMUSG00000031996
Gene Nameamyloid beta (A4) precursor-like protein 2
Synonyms
MMRRC Submission 040418-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2512 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location31149557-31211815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31167677 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 325 (R325H)
Ref Sequence ENSEMBL: ENSMUSP00000149732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072634] [ENSMUST00000079758] [ENSMUST00000213254] [ENSMUST00000217641]
Predicted Effect probably damaging
Transcript: ENSMUST00000072634
AA Change: R325H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072428
Gene: ENSMUSG00000031996
AA Change: R325H

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
A4_EXTRA 42 204 7.91e-123 SMART
low complexity region 218 232 N/A INTRINSIC
coiled coil region 242 269 N/A INTRINSIC
KU 308 361 3.52e-24 SMART
Pfam:APP_E2 365 547 1.6e-71 PFAM
low complexity region 555 568 N/A INTRINSIC
low complexity region 589 595 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Pfam:APP_amyloid 697 747 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079758
SMART Domains Protein: ENSMUSP00000078694
Gene: ENSMUSG00000031996

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
A4_EXTRA 42 204 7.91e-123 SMART
low complexity region 218 232 N/A INTRINSIC
coiled coil region 242 269 N/A INTRINSIC
Pfam:APP_E2 307 492 2.3e-75 PFAM
low complexity region 499 512 N/A INTRINSIC
low complexity region 533 539 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:APP_amyloid 652 703 1.5e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213254
AA Change: R325H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217516
Predicted Effect probably benign
Transcript: ENSMUST00000217641
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes amyloid precursor- like protein 2 (APLP2), which is a member of the APP (amyloid precursor protein) family including APP, APLP1 and APLP2. This protein is ubiquitously expressed. It contains heparin-, copper- and zinc- binding domains at the N-terminus, BPTI/Kunitz inhibitor and E2 domains in the middle region, and transmembrane and intracellular domains at the C-terminus. This protein interacts with major histocompatibility complex (MHC) class I molecules. The synergy of this protein and the APP is required to mediate neuromuscular transmission, spatial learning and synaptic plasticity. This protein has been implicated in the pathogenesis of Alzheimer's disease. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for two different targeted alleles show embryonic lethality, or viability and fertility with increased copper levels in cerebral cortex and liver. Double knockouts with App show high mortality, reduced growth, and neurological symptoms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,726 T60A probably benign Het
2700049A03Rik A G 12: 71,173,171 T831A possibly damaging Het
Actg2 T A 6: 83,526,847 I72F probably damaging Het
Add1 A G 5: 34,616,686 T80A probably benign Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Aptx G A 4: 40,694,917 P140S probably benign Het
C87499 T G 4: 88,628,958 M246L probably damaging Het
Carm1 A G 9: 21,575,412 probably null Het
Carmil2 A T 8: 105,697,393 I1293F probably benign Het
Cdh8 T C 8: 99,400,863 T39A probably benign Het
Col15a1 T A 4: 47,245,868 N206K possibly damaging Het
Copg2 C T 6: 30,896,656 probably null Het
Ctr9 T G 7: 111,046,871 I690S probably damaging Het
Dcaf8 T G 1: 172,189,035 I463S possibly damaging Het
Dcp1b G T 6: 119,206,512 A187S possibly damaging Het
Ddo T A 10: 40,632,939 D58E possibly damaging Het
Dkkl1 G T 7: 45,207,733 R137S probably damaging Het
Dxo A G 17: 34,837,742 N115S probably benign Het
Ep400 A T 5: 110,708,915 probably benign Het
F11 A G 8: 45,261,061 V7A probably benign Het
Fermt1 G T 2: 132,939,518 probably null Het
Fign A T 2: 63,979,799 F376I probably benign Het
Flg2 G T 3: 93,201,775 G370V probably damaging Het
Fndc3a A T 14: 72,556,275 D953E probably benign Het
Fsip2 A T 2: 82,978,167 H1610L probably benign Het
Gfra3 T C 18: 34,704,511 N145D probably benign Het
Inpp4b G T 8: 82,010,550 W525C probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lgi2 A G 5: 52,537,965 *543R probably null Het
Lyn A G 4: 3,745,542 T114A probably benign Het
Lynx1 A G 15: 74,751,320 Y88H probably damaging Het
Map4 C A 9: 110,034,702 P332T possibly damaging Het
Mapk8ip3 A T 17: 24,914,703 C250* probably null Het
Metap1d A G 2: 71,522,610 H261R probably damaging Het
Mfrp T C 9: 44,102,538 V115A probably benign Het
Mtbp A G 15: 55,577,536 Y373C probably damaging Het
Mtor C A 4: 148,530,491 R1628S possibly damaging Het
Muc5b A G 7: 141,859,076 N1920D unknown Het
Myo1d T A 11: 80,779,717 M26L probably benign Het
Neb A C 2: 52,210,831 D643E probably damaging Het
Nme1 A G 11: 93,960,687 F108L possibly damaging Het
Olfr458 A G 6: 42,460,273 S249P probably damaging Het
Olfr893 G T 9: 38,209,374 C54F probably damaging Het
Pan2 T A 10: 128,304,457 D82E probably damaging Het
Pclo A G 5: 14,712,598 D3695G unknown Het
Pcnx4 A T 12: 72,556,799 probably null Het
Plg A G 17: 12,403,229 T479A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ptgis T C 2: 167,207,276 D372G probably damaging Het
Ranbp3l A G 15: 8,968,465 T14A probably benign Het
Rcc1l A T 5: 134,166,669 V230D probably damaging Het
Reln T C 5: 21,979,690 D1609G possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr1 G A 7: 29,103,542 L696F possibly damaging Het
Sacs T A 14: 61,203,080 D858E probably benign Het
Sec16a C T 2: 26,439,025 V993I probably benign Het
Skint5 T A 4: 113,630,419 I901F unknown Het
Slc17a3 A T 13: 23,846,247 I114F probably benign Het
Slc17a7 T A 7: 45,168,864 L71Q probably damaging Het
Slc43a2 T C 11: 75,570,577 S452P probably damaging Het
Smarca4 A G 9: 21,635,698 N173S possibly damaging Het
Tbc1d21 T C 9: 58,362,912 Y161C probably damaging Het
Tpsab1 C A 17: 25,345,107 C94F probably damaging Het
Ubr5 G A 15: 38,002,319 P1496L probably damaging Het
Unc80 G T 1: 66,671,608 A2679S possibly damaging Het
Vdac1 T A 11: 52,384,077 V184E probably damaging Het
Vmn2r24 T A 6: 123,787,026 S287R probably benign Het
Vmn2r91 T C 17: 18,135,786 F572L probably benign Het
Vps13b G A 15: 35,884,555 E3125K probably benign Het
Ythdf3 A G 3: 16,204,895 N406S possibly damaging Het
Zfp708 T C 13: 67,071,187 K158E probably damaging Het
Other mutations in Aplp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02067:Aplp2 APN 9 31150895 missense probably damaging 1.00
IGL02152:Aplp2 APN 9 31211651 missense unknown
IGL02309:Aplp2 APN 9 31167683 missense possibly damaging 0.80
IGL02407:Aplp2 APN 9 31158527 nonsense probably null
IGL02623:Aplp2 APN 9 31178083 splice site probably benign
IGL02737:Aplp2 APN 9 31153416 missense probably benign
IGL02958:Aplp2 APN 9 31164676 splice site probably benign
R0211:Aplp2 UTSW 9 31157790 missense probably damaging 0.99
R0279:Aplp2 UTSW 9 31157790 missense probably damaging 0.99
R1669:Aplp2 UTSW 9 31167733 intron probably benign
R1707:Aplp2 UTSW 9 31150919 missense probably damaging 1.00
R1755:Aplp2 UTSW 9 31177104 missense probably damaging 1.00
R2842:Aplp2 UTSW 9 31157826 missense probably benign 0.12
R4031:Aplp2 UTSW 9 31157730 missense probably benign 0.00
R4115:Aplp2 UTSW 9 31157826 missense probably benign 0.12
R5725:Aplp2 UTSW 9 31157814 missense probably damaging 1.00
R6032:Aplp2 UTSW 9 31150944 missense probably damaging 1.00
R6032:Aplp2 UTSW 9 31150944 missense probably damaging 1.00
R6375:Aplp2 UTSW 9 31157788 missense probably benign 0.00
R7170:Aplp2 UTSW 9 31170443 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGACAGATGCAGTCACAAGG -3'
(R):5'- GAAAGTGCTTCTGTTTGCCTC -3'

Sequencing Primer
(F):5'- GTCACAAGGACAGCCAGG -3'
(R):5'- AAAGTGCTTCTGTTTGCCTCTATTG -3'
Posted On2014-12-04