Incidental Mutation 'R2512:Olfr893'
ID253464
Institutional Source Beutler Lab
Gene Symbol Olfr893
Ensembl Gene ENSMUSG00000093901
Gene Nameolfactory receptor 893
SynonymsGA_x6K02T2PVTD-31889215-31890153, MOR170-11
MMRRC Submission 040418-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R2512 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38208365-38211598 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 38209374 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 54 (C54F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093867] [ENSMUST00000211975]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093867
AA Change: C107F

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091390
Gene: ENSMUSG00000093901
AA Change: C107F

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 1.2e-45 PFAM
Pfam:7tm_1 43 292 8e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211975
AA Change: C105F

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000212815
AA Change: C54F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,726 T60A probably benign Het
2700049A03Rik A G 12: 71,173,171 T831A possibly damaging Het
Actg2 T A 6: 83,526,847 I72F probably damaging Het
Add1 A G 5: 34,616,686 T80A probably benign Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Aplp2 C T 9: 31,167,677 R325H probably damaging Het
Aptx G A 4: 40,694,917 P140S probably benign Het
C87499 T G 4: 88,628,958 M246L probably damaging Het
Carm1 A G 9: 21,575,412 probably null Het
Carmil2 A T 8: 105,697,393 I1293F probably benign Het
Cdh8 T C 8: 99,400,863 T39A probably benign Het
Col15a1 T A 4: 47,245,868 N206K possibly damaging Het
Copg2 C T 6: 30,896,656 probably null Het
Ctr9 T G 7: 111,046,871 I690S probably damaging Het
Dcaf8 T G 1: 172,189,035 I463S possibly damaging Het
Dcp1b G T 6: 119,206,512 A187S possibly damaging Het
Ddo T A 10: 40,632,939 D58E possibly damaging Het
Dkkl1 G T 7: 45,207,733 R137S probably damaging Het
Dxo A G 17: 34,837,742 N115S probably benign Het
Ep400 A T 5: 110,708,915 probably benign Het
F11 A G 8: 45,261,061 V7A probably benign Het
Fermt1 G T 2: 132,939,518 probably null Het
Fign A T 2: 63,979,799 F376I probably benign Het
Flg2 G T 3: 93,201,775 G370V probably damaging Het
Fndc3a A T 14: 72,556,275 D953E probably benign Het
Fsip2 A T 2: 82,978,167 H1610L probably benign Het
Gfra3 T C 18: 34,704,511 N145D probably benign Het
Inpp4b G T 8: 82,010,550 W525C probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lgi2 A G 5: 52,537,965 *543R probably null Het
Lyn A G 4: 3,745,542 T114A probably benign Het
Lynx1 A G 15: 74,751,320 Y88H probably damaging Het
Map4 C A 9: 110,034,702 P332T possibly damaging Het
Mapk8ip3 A T 17: 24,914,703 C250* probably null Het
Metap1d A G 2: 71,522,610 H261R probably damaging Het
Mfrp T C 9: 44,102,538 V115A probably benign Het
Mtbp A G 15: 55,577,536 Y373C probably damaging Het
Mtor C A 4: 148,530,491 R1628S possibly damaging Het
Muc5b A G 7: 141,859,076 N1920D unknown Het
Myo1d T A 11: 80,779,717 M26L probably benign Het
Neb A C 2: 52,210,831 D643E probably damaging Het
Nme1 A G 11: 93,960,687 F108L possibly damaging Het
Olfr458 A G 6: 42,460,273 S249P probably damaging Het
Pan2 T A 10: 128,304,457 D82E probably damaging Het
Pclo A G 5: 14,712,598 D3695G unknown Het
Pcnx4 A T 12: 72,556,799 probably null Het
Plg A G 17: 12,403,229 T479A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ptgis T C 2: 167,207,276 D372G probably damaging Het
Ranbp3l A G 15: 8,968,465 T14A probably benign Het
Rcc1l A T 5: 134,166,669 V230D probably damaging Het
Reln T C 5: 21,979,690 D1609G possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr1 G A 7: 29,103,542 L696F possibly damaging Het
Sacs T A 14: 61,203,080 D858E probably benign Het
Sec16a C T 2: 26,439,025 V993I probably benign Het
Skint5 T A 4: 113,630,419 I901F unknown Het
Slc17a3 A T 13: 23,846,247 I114F probably benign Het
Slc17a7 T A 7: 45,168,864 L71Q probably damaging Het
Slc43a2 T C 11: 75,570,577 S452P probably damaging Het
Smarca4 A G 9: 21,635,698 N173S possibly damaging Het
Tbc1d21 T C 9: 58,362,912 Y161C probably damaging Het
Tpsab1 C A 17: 25,345,107 C94F probably damaging Het
Ubr5 G A 15: 38,002,319 P1496L probably damaging Het
Unc80 G T 1: 66,671,608 A2679S possibly damaging Het
Vdac1 T A 11: 52,384,077 V184E probably damaging Het
Vmn2r24 T A 6: 123,787,026 S287R probably benign Het
Vmn2r91 T C 17: 18,135,786 F572L probably benign Het
Vps13b G A 15: 35,884,555 E3125K probably benign Het
Ythdf3 A G 3: 16,204,895 N406S possibly damaging Het
Zfp708 T C 13: 67,071,187 K158E probably damaging Het
Other mutations in Olfr893
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Olfr893 APN 9 38209238 missense probably damaging 1.00
IGL00914:Olfr893 APN 9 38209799 intron probably null
IGL01563:Olfr893 APN 9 38209701 missense probably damaging 1.00
IGL01696:Olfr893 APN 9 38209049 unclassified probably benign
IGL02064:Olfr893 APN 9 38209578 missense probably damaging 1.00
IGL02605:Olfr893 APN 9 38209236 missense probably damaging 0.99
R0415:Olfr893 UTSW 9 38209973 missense probably benign
R0463:Olfr893 UTSW 9 38209064 missense probably benign 0.00
R0843:Olfr893 UTSW 9 38209283 missense possibly damaging 0.81
R1441:Olfr893 UTSW 9 38209481 missense probably damaging 1.00
R1939:Olfr893 UTSW 9 38209429 nonsense probably null
R4890:Olfr893 UTSW 9 38209290 missense probably benign 0.00
R5439:Olfr893 UTSW 9 38209754 missense probably benign 0.00
R6918:Olfr893 UTSW 9 38209652 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACCGTGATGGGAAATTTGAGC -3'
(R):5'- TTCGAATCACAAAACTTGAGCC -3'

Sequencing Primer
(F):5'- CCGTGATGGGAAATTTGAGCTTAATG -3'
(R):5'- TGAGCCTAATCATGCAGCCAGTATG -3'
Posted On2014-12-04