Incidental Mutation 'R2512:Nme1'
ID253485
Institutional Source Beutler Lab
Gene Symbol Nme1
Ensembl Gene ENSMUSG00000037601
Gene NameNME/NM23 nucleoside diphosphate kinase 1
SynonymsNDPK-A, non-metastatic cells 1, protein (NM23A) expressed in, NM23-M1
MMRRC Submission 040418-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2512 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location93956979-93968521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93960687 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 108 (F108L)
Ref Sequence ENSEMBL: ENSMUSP00000132590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021217] [ENSMUST00000021220] [ENSMUST00000072566] [ENSMUST00000107844] [ENSMUST00000135884] [ENSMUST00000170303]
Predicted Effect probably benign
Transcript: ENSMUST00000021217
SMART Domains Protein: ENSMUSP00000021217
Gene: ENSMUSG00000020857

DomainStartEndE-ValueType
NDK 4 141 2.8e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021220
AA Change: F108L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000021220
Gene: ENSMUSG00000037601
AA Change: F108L

DomainStartEndE-ValueType
NDK 4 127 8.86e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072566
SMART Domains Protein: ENSMUSP00000103476
Gene: ENSMUSG00000020857

DomainStartEndE-ValueType
NDK 4 141 2.8e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107844
SMART Domains Protein: ENSMUSP00000103475
Gene: ENSMUSG00000037601

DomainStartEndE-ValueType
NDK 4 102 4.83e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135884
AA Change: F108L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000117022
Gene: ENSMUSG00000037601
AA Change: F108L

DomainStartEndE-ValueType
NDK 4 141 5.74e-87 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170303
AA Change: F108L

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132590
Gene: ENSMUSG00000091228
AA Change: F108L

DomainStartEndE-ValueType
NDK 4 118 7.56e-55 SMART
NDK 119 256 2.8e-90 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene (NME1) was identified because of its reduced mRNA transcript levels in highly metastatic cells. Nucleoside diphosphate kinase (NDK) exists as a hexamer composed of 'A' (encoded by this gene) and 'B' (encoded by NME2) isoforms. Mutations in this gene have been identified in aggressive neuroblastomas. Two transcript variants encoding different isoforms have been found for this gene. Co-transcription of this gene and the neighboring downstream gene (NME2) generates naturally-occurring transcripts (NME1-NME2), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice for a targeted mutation of this gene are born normally, but exhibited high perinatal mortality of all genotypes on congenic backgrounds. This appears to be a maternal effect because the presence of a single functioning allele in females can prevent this mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,726 T60A probably benign Het
2700049A03Rik A G 12: 71,173,171 T831A possibly damaging Het
Actg2 T A 6: 83,526,847 I72F probably damaging Het
Add1 A G 5: 34,616,686 T80A probably benign Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Aplp2 C T 9: 31,167,677 R325H probably damaging Het
Aptx G A 4: 40,694,917 P140S probably benign Het
C87499 T G 4: 88,628,958 M246L probably damaging Het
Carm1 A G 9: 21,575,412 probably null Het
Carmil2 A T 8: 105,697,393 I1293F probably benign Het
Cdh8 T C 8: 99,400,863 T39A probably benign Het
Col15a1 T A 4: 47,245,868 N206K possibly damaging Het
Copg2 C T 6: 30,896,656 probably null Het
Ctr9 T G 7: 111,046,871 I690S probably damaging Het
Dcaf8 T G 1: 172,189,035 I463S possibly damaging Het
Dcp1b G T 6: 119,206,512 A187S possibly damaging Het
Ddo T A 10: 40,632,939 D58E possibly damaging Het
Dkkl1 G T 7: 45,207,733 R137S probably damaging Het
Dxo A G 17: 34,837,742 N115S probably benign Het
Ep400 A T 5: 110,708,915 probably benign Het
F11 A G 8: 45,261,061 V7A probably benign Het
Fermt1 G T 2: 132,939,518 probably null Het
Fign A T 2: 63,979,799 F376I probably benign Het
Flg2 G T 3: 93,201,775 G370V probably damaging Het
Fndc3a A T 14: 72,556,275 D953E probably benign Het
Fsip2 A T 2: 82,978,167 H1610L probably benign Het
Gfra3 T C 18: 34,704,511 N145D probably benign Het
Inpp4b G T 8: 82,010,550 W525C probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lgi2 A G 5: 52,537,965 *543R probably null Het
Lyn A G 4: 3,745,542 T114A probably benign Het
Lynx1 A G 15: 74,751,320 Y88H probably damaging Het
Map4 C A 9: 110,034,702 P332T possibly damaging Het
Mapk8ip3 A T 17: 24,914,703 C250* probably null Het
Metap1d A G 2: 71,522,610 H261R probably damaging Het
Mfrp T C 9: 44,102,538 V115A probably benign Het
Mtbp A G 15: 55,577,536 Y373C probably damaging Het
Mtor C A 4: 148,530,491 R1628S possibly damaging Het
Muc5b A G 7: 141,859,076 N1920D unknown Het
Myo1d T A 11: 80,779,717 M26L probably benign Het
Neb A C 2: 52,210,831 D643E probably damaging Het
Olfr458 A G 6: 42,460,273 S249P probably damaging Het
Olfr893 G T 9: 38,209,374 C54F probably damaging Het
Pan2 T A 10: 128,304,457 D82E probably damaging Het
Pclo A G 5: 14,712,598 D3695G unknown Het
Pcnx4 A T 12: 72,556,799 probably null Het
Plg A G 17: 12,403,229 T479A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ptgis T C 2: 167,207,276 D372G probably damaging Het
Ranbp3l A G 15: 8,968,465 T14A probably benign Het
Rcc1l A T 5: 134,166,669 V230D probably damaging Het
Reln T C 5: 21,979,690 D1609G possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr1 G A 7: 29,103,542 L696F possibly damaging Het
Sacs T A 14: 61,203,080 D858E probably benign Het
Sec16a C T 2: 26,439,025 V993I probably benign Het
Skint5 T A 4: 113,630,419 I901F unknown Het
Slc17a3 A T 13: 23,846,247 I114F probably benign Het
Slc17a7 T A 7: 45,168,864 L71Q probably damaging Het
Slc43a2 T C 11: 75,570,577 S452P probably damaging Het
Smarca4 A G 9: 21,635,698 N173S possibly damaging Het
Tbc1d21 T C 9: 58,362,912 Y161C probably damaging Het
Tpsab1 C A 17: 25,345,107 C94F probably damaging Het
Ubr5 G A 15: 38,002,319 P1496L probably damaging Het
Unc80 G T 1: 66,671,608 A2679S possibly damaging Het
Vdac1 T A 11: 52,384,077 V184E probably damaging Het
Vmn2r24 T A 6: 123,787,026 S287R probably benign Het
Vmn2r91 T C 17: 18,135,786 F572L probably benign Het
Vps13b G A 15: 35,884,555 E3125K probably benign Het
Ythdf3 A G 3: 16,204,895 N406S possibly damaging Het
Zfp708 T C 13: 67,071,187 K158E probably damaging Het
Other mutations in Nme1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Nme1 APN 11 93959491 missense possibly damaging 0.58
IGL02533:Nme1 APN 11 93959431 missense possibly damaging 0.89
R1695:Nme1 UTSW 11 93960767 missense probably benign 0.37
R4182:Nme1 UTSW 11 93960804 missense probably benign 0.00
R4701:Nme1 UTSW 11 93965908 missense probably damaging 1.00
R6928:Nme1 UTSW 11 93959403 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCAGAAGAGATGGCTCAGTT -3'
(R):5'- TGGCTTTGAATTTCCATGTGCCA -3'

Sequencing Primer
(F):5'- TAATTCCTAGGATCCACATGGGGC -3'
(R):5'- GAATTTCCATGTGCCAGGTTTTC -3'
Posted On2014-12-04