Incidental Mutation 'R2512:Zfp708'
ID253495
Institutional Source Beutler Lab
Gene Symbol Zfp708
Ensembl Gene ENSMUSG00000058883
Gene Namezinc finger protein 708
Synonyms
MMRRC Submission 040418-MU
Accession Numbers

Ncbi RefSeq: NM_001012325.2, NM_001012448.2, NM_001012449.2; MGI:3040674

Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R2512 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67069399-67097976 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67071187 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 158 (K158E)
Ref Sequence ENSEMBL: ENSMUSP00000139928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109742] [ENSMUST00000109743] [ENSMUST00000186303] [ENSMUST00000190566]
Predicted Effect probably damaging
Transcript: ENSMUST00000109742
AA Change: K191E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105364
Gene: ENSMUSG00000058883
AA Change: K191E

DomainStartEndE-ValueType
KRAB 5 65 3.75e-28 SMART
ZnF_C2H2 81 103 1.12e-3 SMART
ZnF_C2H2 109 131 5.14e-3 SMART
ZnF_C2H2 137 159 1.1e-2 SMART
ZnF_C2H2 165 187 6.78e-3 SMART
ZnF_C2H2 193 215 1.47e-3 SMART
ZnF_C2H2 221 243 7.78e-3 SMART
ZnF_C2H2 249 271 1.95e-3 SMART
ZnF_C2H2 277 299 5.21e-4 SMART
ZnF_C2H2 305 327 7.9e-4 SMART
ZnF_C2H2 333 355 8.34e-3 SMART
ZnF_C2H2 361 383 1.3e-4 SMART
ZnF_C2H2 389 411 4.87e-4 SMART
ZnF_C2H2 417 439 5.14e-3 SMART
ZnF_C2H2 445 467 1.2e-3 SMART
ZnF_C2H2 473 495 1.72e-4 SMART
ZnF_C2H2 501 523 1.6e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109743
AA Change: K203E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105365
Gene: ENSMUSG00000058883
AA Change: K203E

DomainStartEndE-ValueType
KRAB 17 77 3.75e-28 SMART
ZnF_C2H2 93 115 1.12e-3 SMART
ZnF_C2H2 121 143 5.14e-3 SMART
ZnF_C2H2 149 171 1.1e-2 SMART
ZnF_C2H2 177 199 6.78e-3 SMART
ZnF_C2H2 205 227 1.47e-3 SMART
ZnF_C2H2 233 255 7.78e-3 SMART
ZnF_C2H2 261 283 1.95e-3 SMART
ZnF_C2H2 289 311 5.21e-4 SMART
ZnF_C2H2 317 339 7.9e-4 SMART
ZnF_C2H2 345 367 8.34e-3 SMART
ZnF_C2H2 373 395 1.3e-4 SMART
ZnF_C2H2 401 423 4.87e-4 SMART
ZnF_C2H2 429 451 5.14e-3 SMART
ZnF_C2H2 457 479 1.2e-3 SMART
ZnF_C2H2 485 507 1.72e-4 SMART
ZnF_C2H2 513 535 1.6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185954
Predicted Effect probably benign
Transcript: ENSMUST00000186303
SMART Domains Protein: ENSMUSP00000140296
Gene: ENSMUSG00000100235

DomainStartEndE-ValueType
KRAB 1 32 9.7e-3 SMART
ZnF_C2H2 47 69 1.8e-6 SMART
ZnF_C2H2 75 97 6.7e-5 SMART
ZnF_C2H2 103 125 7.6e-6 SMART
ZnF_C2H2 131 153 7.6e-6 SMART
ZnF_C2H2 159 181 1.4e-7 SMART
ZnF_C2H2 187 209 7.6e-6 SMART
ZnF_C2H2 215 237 5.5e-5 SMART
ZnF_C2H2 243 265 8.9e-7 SMART
ZnF_C2H2 271 293 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190566
AA Change: K158E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139928
Gene: ENSMUSG00000058883
AA Change: K158E

DomainStartEndE-ValueType
KRAB 1 32 1.6e-3 SMART
ZnF_C2H2 48 70 4.7e-6 SMART
ZnF_C2H2 76 98 2.1e-5 SMART
ZnF_C2H2 104 126 4.6e-5 SMART
ZnF_C2H2 132 154 2.9e-5 SMART
ZnF_C2H2 160 182 6.3e-6 SMART
ZnF_C2H2 188 210 3.3e-5 SMART
ZnF_C2H2 216 238 8.2e-6 SMART
ZnF_C2H2 244 266 2.2e-6 SMART
ZnF_C2H2 272 294 3.4e-6 SMART
ZnF_C2H2 300 322 3.6e-5 SMART
ZnF_C2H2 328 350 5.5e-7 SMART
ZnF_C2H2 356 378 2.1e-6 SMART
ZnF_C2H2 384 406 2.1e-5 SMART
ZnF_C2H2 412 434 5e-6 SMART
ZnF_C2H2 440 462 7.2e-7 SMART
ZnF_C2H2 468 490 6.8e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224641
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,726 T60A probably benign Het
2700049A03Rik A G 12: 71,173,171 T831A possibly damaging Het
Actg2 T A 6: 83,526,847 I72F probably damaging Het
Add1 A G 5: 34,616,686 T80A probably benign Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Aplp2 C T 9: 31,167,677 R325H probably damaging Het
Aptx G A 4: 40,694,917 P140S probably benign Het
C87499 T G 4: 88,628,958 M246L probably damaging Het
Carm1 A G 9: 21,575,412 probably null Het
Carmil2 A T 8: 105,697,393 I1293F probably benign Het
Cdh8 T C 8: 99,400,863 T39A probably benign Het
Col15a1 T A 4: 47,245,868 N206K possibly damaging Het
Copg2 C T 6: 30,896,656 probably null Het
Ctr9 T G 7: 111,046,871 I690S probably damaging Het
Dcaf8 T G 1: 172,189,035 I463S possibly damaging Het
Dcp1b G T 6: 119,206,512 A187S possibly damaging Het
Ddo T A 10: 40,632,939 D58E possibly damaging Het
Dkkl1 G T 7: 45,207,733 R137S probably damaging Het
Dxo A G 17: 34,837,742 N115S probably benign Het
Ep400 A T 5: 110,708,915 probably benign Het
F11 A G 8: 45,261,061 V7A probably benign Het
Fermt1 G T 2: 132,939,518 probably null Het
Fign A T 2: 63,979,799 F376I probably benign Het
Flg2 G T 3: 93,201,775 G370V probably damaging Het
Fndc3a A T 14: 72,556,275 D953E probably benign Het
Fsip2 A T 2: 82,978,167 H1610L probably benign Het
Gfra3 T C 18: 34,704,511 N145D probably benign Het
Inpp4b G T 8: 82,010,550 W525C probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lgi2 A G 5: 52,537,965 *543R probably null Het
Lyn A G 4: 3,745,542 T114A probably benign Het
Lynx1 A G 15: 74,751,320 Y88H probably damaging Het
Map4 C A 9: 110,034,702 P332T possibly damaging Het
Mapk8ip3 A T 17: 24,914,703 C250* probably null Het
Metap1d A G 2: 71,522,610 H261R probably damaging Het
Mfrp T C 9: 44,102,538 V115A probably benign Het
Mtbp A G 15: 55,577,536 Y373C probably damaging Het
Mtor C A 4: 148,530,491 R1628S possibly damaging Het
Muc5b A G 7: 141,859,076 N1920D unknown Het
Myo1d T A 11: 80,779,717 M26L probably benign Het
Neb A C 2: 52,210,831 D643E probably damaging Het
Nme1 A G 11: 93,960,687 F108L possibly damaging Het
Olfr458 A G 6: 42,460,273 S249P probably damaging Het
Olfr893 G T 9: 38,209,374 C54F probably damaging Het
Pan2 T A 10: 128,304,457 D82E probably damaging Het
Pclo A G 5: 14,712,598 D3695G unknown Het
Pcnx4 A T 12: 72,556,799 probably null Het
Plg A G 17: 12,403,229 T479A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ptgis T C 2: 167,207,276 D372G probably damaging Het
Ranbp3l A G 15: 8,968,465 T14A probably benign Het
Rcc1l A T 5: 134,166,669 V230D probably damaging Het
Reln T C 5: 21,979,690 D1609G possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr1 G A 7: 29,103,542 L696F possibly damaging Het
Sacs T A 14: 61,203,080 D858E probably benign Het
Sec16a C T 2: 26,439,025 V993I probably benign Het
Skint5 T A 4: 113,630,419 I901F unknown Het
Slc17a3 A T 13: 23,846,247 I114F probably benign Het
Slc17a7 T A 7: 45,168,864 L71Q probably damaging Het
Slc43a2 T C 11: 75,570,577 S452P probably damaging Het
Smarca4 A G 9: 21,635,698 N173S possibly damaging Het
Tbc1d21 T C 9: 58,362,912 Y161C probably damaging Het
Tpsab1 C A 17: 25,345,107 C94F probably damaging Het
Ubr5 G A 15: 38,002,319 P1496L probably damaging Het
Unc80 G T 1: 66,671,608 A2679S possibly damaging Het
Vdac1 T A 11: 52,384,077 V184E probably damaging Het
Vmn2r24 T A 6: 123,787,026 S287R probably benign Het
Vmn2r91 T C 17: 18,135,786 F572L probably benign Het
Vps13b G A 15: 35,884,555 E3125K probably benign Het
Ythdf3 A G 3: 16,204,895 N406S possibly damaging Het
Other mutations in Zfp708
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0024:Zfp708 UTSW 13 67070920 nonsense probably null
R0611:Zfp708 UTSW 13 67070311 missense probably benign 0.18
R0627:Zfp708 UTSW 13 67070717 nonsense probably null
R1019:Zfp708 UTSW 13 67074098 missense probably benign 0.05
R2230:Zfp708 UTSW 13 67070972 nonsense probably null
R5718:Zfp708 UTSW 13 67070458 missense probably benign 0.44
R6128:Zfp708 UTSW 13 67074901 missense probably damaging 1.00
R6644:Zfp708 UTSW 13 67070721 missense possibly damaging 0.88
R6720:Zfp708 UTSW 13 67071432 missense probably damaging 1.00
R7082:Zfp708 UTSW 13 67071136 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- CCACAGTCTTTGCATTCATACGG -3'
(R):5'- GGGTGAGCGGTATGAATATAACAT -3'

Sequencing Primer
(F):5'- CATACGGTTTTTCTCCACTATGTG -3'
(R):5'- TTCATACTGGAGAGAGGCCCTAC -3'
Posted On2014-12-04