Incidental Mutation 'R2512:Sacs'
ID253497
Institutional Source Beutler Lab
Gene Symbol Sacs
Ensembl Gene ENSMUSG00000048279
Gene Namesacsin
SynonymsE130115J16Rik
MMRRC Submission 040418-MU
Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R2512 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location61138457-61240695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61203080 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 858 (D858E)
Ref Sequence ENSEMBL: ENSMUSP00000113377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119509] [ENSMUST00000119943] [ENSMUST00000227570] [ENSMUST00000229692]
Predicted Effect probably benign
Transcript: ENSMUST00000089394
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119509
SMART Domains Protein: ENSMUSP00000113007
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
SCOP:d1byqa_ 87 202 5e-3 SMART
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119943
AA Change: D858E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: D858E

DomainStartEndE-ValueType
internal_repeat_1 61 514 1.35e-52 PROSPERO
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1526 1537 N/A INTRINSIC
low complexity region 2454 2463 N/A INTRINSIC
internal_repeat_1 2475 2934 1.35e-52 PROSPERO
low complexity region 3751 3760 N/A INTRINSIC
low complexity region 3997 4012 N/A INTRINSIC
low complexity region 4285 4300 N/A INTRINSIC
Blast:DnaJ 4304 4363 1e-31 BLAST
PDB:1IUR|A 4309 4376 5e-39 PDB
SCOP:d1gh6a_ 4317 4407 2e-3 SMART
HEPN 4454 4570 9.49e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150222
Predicted Effect probably benign
Transcript: ENSMUST00000227570
Predicted Effect probably benign
Transcript: ENSMUST00000229692
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,726 T60A probably benign Het
2700049A03Rik A G 12: 71,173,171 T831A possibly damaging Het
Actg2 T A 6: 83,526,847 I72F probably damaging Het
Add1 A G 5: 34,616,686 T80A probably benign Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Aplp2 C T 9: 31,167,677 R325H probably damaging Het
Aptx G A 4: 40,694,917 P140S probably benign Het
C87499 T G 4: 88,628,958 M246L probably damaging Het
Carm1 A G 9: 21,575,412 probably null Het
Carmil2 A T 8: 105,697,393 I1293F probably benign Het
Cdh8 T C 8: 99,400,863 T39A probably benign Het
Col15a1 T A 4: 47,245,868 N206K possibly damaging Het
Copg2 C T 6: 30,896,656 probably null Het
Ctr9 T G 7: 111,046,871 I690S probably damaging Het
Dcaf8 T G 1: 172,189,035 I463S possibly damaging Het
Dcp1b G T 6: 119,206,512 A187S possibly damaging Het
Ddo T A 10: 40,632,939 D58E possibly damaging Het
Dkkl1 G T 7: 45,207,733 R137S probably damaging Het
Dxo A G 17: 34,837,742 N115S probably benign Het
Ep400 A T 5: 110,708,915 probably benign Het
F11 A G 8: 45,261,061 V7A probably benign Het
Fermt1 G T 2: 132,939,518 probably null Het
Fign A T 2: 63,979,799 F376I probably benign Het
Flg2 G T 3: 93,201,775 G370V probably damaging Het
Fndc3a A T 14: 72,556,275 D953E probably benign Het
Fsip2 A T 2: 82,978,167 H1610L probably benign Het
Gfra3 T C 18: 34,704,511 N145D probably benign Het
Inpp4b G T 8: 82,010,550 W525C probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lgi2 A G 5: 52,537,965 *543R probably null Het
Lyn A G 4: 3,745,542 T114A probably benign Het
Lynx1 A G 15: 74,751,320 Y88H probably damaging Het
Map4 C A 9: 110,034,702 P332T possibly damaging Het
Mapk8ip3 A T 17: 24,914,703 C250* probably null Het
Metap1d A G 2: 71,522,610 H261R probably damaging Het
Mfrp T C 9: 44,102,538 V115A probably benign Het
Mtbp A G 15: 55,577,536 Y373C probably damaging Het
Mtor C A 4: 148,530,491 R1628S possibly damaging Het
Muc5b A G 7: 141,859,076 N1920D unknown Het
Myo1d T A 11: 80,779,717 M26L probably benign Het
Neb A C 2: 52,210,831 D643E probably damaging Het
Nme1 A G 11: 93,960,687 F108L possibly damaging Het
Olfr458 A G 6: 42,460,273 S249P probably damaging Het
Olfr893 G T 9: 38,209,374 C54F probably damaging Het
Pan2 T A 10: 128,304,457 D82E probably damaging Het
Pclo A G 5: 14,712,598 D3695G unknown Het
Pcnx4 A T 12: 72,556,799 probably null Het
Plg A G 17: 12,403,229 T479A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ptgis T C 2: 167,207,276 D372G probably damaging Het
Ranbp3l A G 15: 8,968,465 T14A probably benign Het
Rcc1l A T 5: 134,166,669 V230D probably damaging Het
Reln T C 5: 21,979,690 D1609G possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr1 G A 7: 29,103,542 L696F possibly damaging Het
Sec16a C T 2: 26,439,025 V993I probably benign Het
Skint5 T A 4: 113,630,419 I901F unknown Het
Slc17a3 A T 13: 23,846,247 I114F probably benign Het
Slc17a7 T A 7: 45,168,864 L71Q probably damaging Het
Slc43a2 T C 11: 75,570,577 S452P probably damaging Het
Smarca4 A G 9: 21,635,698 N173S possibly damaging Het
Tbc1d21 T C 9: 58,362,912 Y161C probably damaging Het
Tpsab1 C A 17: 25,345,107 C94F probably damaging Het
Ubr5 G A 15: 38,002,319 P1496L probably damaging Het
Unc80 G T 1: 66,671,608 A2679S possibly damaging Het
Vdac1 T A 11: 52,384,077 V184E probably damaging Het
Vmn2r24 T A 6: 123,787,026 S287R probably benign Het
Vmn2r91 T C 17: 18,135,786 F572L probably benign Het
Vps13b G A 15: 35,884,555 E3125K probably benign Het
Ythdf3 A G 3: 16,204,895 N406S possibly damaging Het
Zfp708 T C 13: 67,071,187 K158E probably damaging Het
Other mutations in Sacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Sacs APN 14 61191635 missense possibly damaging 0.64
IGL01839:Sacs APN 14 61183945 intron probably benign
IGL02024:Sacs APN 14 61189678 missense probably damaging 0.96
IGL02247:Sacs APN 14 61192535 missense probably damaging 1.00
F6893:Sacs UTSW 14 61212976 missense probably benign
IGL03052:Sacs UTSW 14 61207858 missense probably damaging 0.99
R0090:Sacs UTSW 14 61205440 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0390:Sacs UTSW 14 61205640 missense possibly damaging 0.92
R0479:Sacs UTSW 14 61191479 missense probably damaging 0.99
R0556:Sacs UTSW 14 61183958 missense probably damaging 0.99
R0673:Sacs UTSW 14 61210215 missense possibly damaging 0.89
R0748:Sacs UTSW 14 61209265 missense probably damaging 0.99
R0931:Sacs UTSW 14 61203495 missense probably benign
R0972:Sacs UTSW 14 61211963 nonsense probably null
R1281:Sacs UTSW 14 61191801 missense probably benign 0.02
R1340:Sacs UTSW 14 61204509 missense probably damaging 0.98
R1351:Sacs UTSW 14 61202761 missense probably benign 0.00
R1499:Sacs UTSW 14 61213704 missense possibly damaging 0.70
R1538:Sacs UTSW 14 61210059 missense probably damaging 0.98
R1581:Sacs UTSW 14 61213679 missense probably damaging 0.96
R1599:Sacs UTSW 14 61203638 missense probably benign
R1631:Sacs UTSW 14 61210732 nonsense probably null
R1635:Sacs UTSW 14 61203828 missense probably damaging 0.98
R1655:Sacs UTSW 14 61191782 missense probably benign
R1660:Sacs UTSW 14 61209009 missense probably damaging 0.99
R1707:Sacs UTSW 14 61209762 missense probably benign 0.01
R1733:Sacs UTSW 14 61205454 missense probably damaging 1.00
R1772:Sacs UTSW 14 61210897 missense probably damaging 1.00
R1976:Sacs UTSW 14 61202895 missense probably benign
R2055:Sacs UTSW 14 61214049 missense probably damaging 0.97
R2083:Sacs UTSW 14 61206506 missense possibly damaging 0.69
R2091:Sacs UTSW 14 61191919 missense possibly damaging 0.95
R2105:Sacs UTSW 14 61173441 missense possibly damaging 0.90
R2109:Sacs UTSW 14 61173453 splice site probably null
R2117:Sacs UTSW 14 61213771 missense probably benign 0.01
R2122:Sacs UTSW 14 61212316 missense probably damaging 1.00
R2148:Sacs UTSW 14 61173378 missense probably damaging 0.97
R2151:Sacs UTSW 14 61209640 missense probably damaging 1.00
R2231:Sacs UTSW 14 61205929 unclassified probably null
R2248:Sacs UTSW 14 61212802 missense probably damaging 1.00
R2271:Sacs UTSW 14 61204660 missense probably benign 0.06
R2314:Sacs UTSW 14 61207759 missense probably benign 0.17
R2436:Sacs UTSW 14 61202905 missense possibly damaging 0.94
R2445:Sacs UTSW 14 61205206 missense probably damaging 1.00
R3434:Sacs UTSW 14 61212303 missense probably damaging 1.00
R3785:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3786:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3796:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3798:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3872:Sacs UTSW 14 61148068 missense probably benign 0.30
R3873:Sacs UTSW 14 61192286 missense possibly damaging 0.64
R3892:Sacs UTSW 14 61204387 missense probably damaging 0.98
R4184:Sacs UTSW 14 61213944 missense probably damaging 0.97
R4204:Sacs UTSW 14 61173443 missense possibly damaging 0.93
R4249:Sacs UTSW 14 61203457 missense probably benign 0.02
R4256:Sacs UTSW 14 61206337 missense probably damaging 1.00
R4370:Sacs UTSW 14 61212309 missense probably damaging 1.00
R4445:Sacs UTSW 14 61204686 missense probably benign 0.30
R4503:Sacs UTSW 14 61207603 missense probably damaging 1.00
R4548:Sacs UTSW 14 61191938 missense probably damaging 1.00
R4582:Sacs UTSW 14 61191698 missense probably damaging 1.00
R4613:Sacs UTSW 14 61211797 intron probably null
R4639:Sacs UTSW 14 61207268 missense probably benign 0.12
R4697:Sacs UTSW 14 61212747 missense probably benign 0.19
R4706:Sacs UTSW 14 61204273 missense probably damaging 1.00
R4717:Sacs UTSW 14 61212855 missense probably damaging 1.00
R4777:Sacs UTSW 14 61211809 missense probably damaging 1.00
R4888:Sacs UTSW 14 61212198 missense probably damaging 1.00
R4913:Sacs UTSW 14 61213797 missense probably benign 0.17
R4973:Sacs UTSW 14 61213122 missense probably damaging 1.00
R4986:Sacs UTSW 14 61213043 nonsense probably null
R5090:Sacs UTSW 14 61205253 missense probably damaging 1.00
R5243:Sacs UTSW 14 61205957 nonsense probably null
R5292:Sacs UTSW 14 61211983 missense probably damaging 1.00
R5308:Sacs UTSW 14 61192400 missense probably benign 0.21
R5337:Sacs UTSW 14 61193514 intron probably benign
R5502:Sacs UTSW 14 61206100 missense probably damaging 1.00
R5586:Sacs UTSW 14 61206441 nonsense probably null
R5692:Sacs UTSW 14 61207839 missense probably benign 0.00
R5725:Sacs UTSW 14 61211110 missense probably damaging 1.00
R5854:Sacs UTSW 14 61211547 missense probably damaging 1.00
R5959:Sacs UTSW 14 61212400 missense probably damaging 0.99
R5960:Sacs UTSW 14 61208695 missense probably benign 0.30
R5968:Sacs UTSW 14 61189629 missense probably damaging 0.99
R5983:Sacs UTSW 14 61205199 missense probably damaging 1.00
R5992:Sacs UTSW 14 61205543 missense probably damaging 1.00
R6076:Sacs UTSW 14 61204536 nonsense probably null
R6175:Sacs UTSW 14 61212826 missense possibly damaging 0.82
R6347:Sacs UTSW 14 61211160 missense probably damaging 1.00
R6357:Sacs UTSW 14 61208824 missense possibly damaging 0.47
R6415:Sacs UTSW 14 61205359 missense probably damaging 1.00
R6469:Sacs UTSW 14 61191248 missense probably damaging 1.00
R6503:Sacs UTSW 14 61211361 missense probably benign 0.00
R6523:Sacs UTSW 14 61202961 missense probably damaging 0.99
R6615:Sacs UTSW 14 61208934 missense probably benign 0.15
R6729:Sacs UTSW 14 61210518 missense probably damaging 1.00
R6797:Sacs UTSW 14 61213073 missense probably damaging 1.00
R6852:Sacs UTSW 14 61179288 missense possibly damaging 0.87
R6922:Sacs UTSW 14 61211425 missense probably damaging 1.00
X0067:Sacs UTSW 14 61208019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCTTTCATGGCTTAAGATGG -3'
(R):5'- CTGGTATCAGTTAAGCTGGCC -3'

Sequencing Primer
(F):5'- TATTTGATGAGATGCCACTTATCCC -3'
(R):5'- GCTGGCCAAAAACTTCCTTAGAG -3'
Posted On2014-12-04