Incidental Mutation 'R2512:Ubr5'
ID253504
Institutional Source Beutler Lab
Gene Symbol Ubr5
Ensembl Gene ENSMUSG00000037487
Gene Nameubiquitin protein ligase E3 component n-recognin 5
SynonymsEdd, 4432411E13Rik, Edd1
MMRRC Submission 040418-MU
Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2512 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location37967328-38078854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38002319 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1496 (P1496L)
Ref Sequence ENSEMBL: ENSMUSP00000154293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]
Predicted Effect probably damaging
Transcript: ENSMUST00000110336
AA Change: P1490L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: P1490L

DomainStartEndE-ValueType
low complexity region 94 111 N/A INTRINSIC
low complexity region 129 156 N/A INTRINSIC
Pfam:E3_UbLigase_EDD 179 230 9.7e-35 PFAM
low complexity region 282 323 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
low complexity region 860 870 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
low complexity region 970 999 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
ZnF_UBR1 1177 1244 5.42e-27 SMART
low complexity region 1396 1405 N/A INTRINSIC
low complexity region 1524 1537 N/A INTRINSIC
low complexity region 1567 1613 N/A INTRINSIC
low complexity region 1641 1657 N/A INTRINSIC
low complexity region 1662 1687 N/A INTRINSIC
low complexity region 1726 1742 N/A INTRINSIC
low complexity region 1759 1789 N/A INTRINSIC
low complexity region 1879 1890 N/A INTRINSIC
low complexity region 1972 1983 N/A INTRINSIC
low complexity region 1986 1997 N/A INTRINSIC
Blast:HECTc 2271 2313 2e-6 BLAST
low complexity region 2329 2366 N/A INTRINSIC
PolyA 2389 2452 3.97e-33 SMART
HECTc 2432 2798 1e-151 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226137
Predicted Effect probably damaging
Transcript: ENSMUST00000226414
AA Change: P1496L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228504
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,726 T60A probably benign Het
2700049A03Rik A G 12: 71,173,171 T831A possibly damaging Het
Actg2 T A 6: 83,526,847 I72F probably damaging Het
Add1 A G 5: 34,616,686 T80A probably benign Het
Alpk2 G A 18: 65,350,520 T139M probably damaging Het
Aplp2 C T 9: 31,167,677 R325H probably damaging Het
Aptx G A 4: 40,694,917 P140S probably benign Het
C87499 T G 4: 88,628,958 M246L probably damaging Het
Carm1 A G 9: 21,575,412 probably null Het
Carmil2 A T 8: 105,697,393 I1293F probably benign Het
Cdh8 T C 8: 99,400,863 T39A probably benign Het
Col15a1 T A 4: 47,245,868 N206K possibly damaging Het
Copg2 C T 6: 30,896,656 probably null Het
Ctr9 T G 7: 111,046,871 I690S probably damaging Het
Dcaf8 T G 1: 172,189,035 I463S possibly damaging Het
Dcp1b G T 6: 119,206,512 A187S possibly damaging Het
Ddo T A 10: 40,632,939 D58E possibly damaging Het
Dkkl1 G T 7: 45,207,733 R137S probably damaging Het
Dxo A G 17: 34,837,742 N115S probably benign Het
Ep400 A T 5: 110,708,915 probably benign Het
F11 A G 8: 45,261,061 V7A probably benign Het
Fermt1 G T 2: 132,939,518 probably null Het
Fign A T 2: 63,979,799 F376I probably benign Het
Flg2 G T 3: 93,201,775 G370V probably damaging Het
Fndc3a A T 14: 72,556,275 D953E probably benign Het
Fsip2 A T 2: 82,978,167 H1610L probably benign Het
Gfra3 T C 18: 34,704,511 N145D probably benign Het
Inpp4b G T 8: 82,010,550 W525C probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lgi2 A G 5: 52,537,965 *543R probably null Het
Lyn A G 4: 3,745,542 T114A probably benign Het
Lynx1 A G 15: 74,751,320 Y88H probably damaging Het
Map4 C A 9: 110,034,702 P332T possibly damaging Het
Mapk8ip3 A T 17: 24,914,703 C250* probably null Het
Metap1d A G 2: 71,522,610 H261R probably damaging Het
Mfrp T C 9: 44,102,538 V115A probably benign Het
Mtbp A G 15: 55,577,536 Y373C probably damaging Het
Mtor C A 4: 148,530,491 R1628S possibly damaging Het
Muc5b A G 7: 141,859,076 N1920D unknown Het
Myo1d T A 11: 80,779,717 M26L probably benign Het
Neb A C 2: 52,210,831 D643E probably damaging Het
Nme1 A G 11: 93,960,687 F108L possibly damaging Het
Olfr458 A G 6: 42,460,273 S249P probably damaging Het
Olfr893 G T 9: 38,209,374 C54F probably damaging Het
Pan2 T A 10: 128,304,457 D82E probably damaging Het
Pclo A G 5: 14,712,598 D3695G unknown Het
Pcnx4 A T 12: 72,556,799 probably null Het
Plg A G 17: 12,403,229 T479A probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ptgis T C 2: 167,207,276 D372G probably damaging Het
Ranbp3l A G 15: 8,968,465 T14A probably benign Het
Rcc1l A T 5: 134,166,669 V230D probably damaging Het
Reln T C 5: 21,979,690 D1609G possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr1 G A 7: 29,103,542 L696F possibly damaging Het
Sacs T A 14: 61,203,080 D858E probably benign Het
Sec16a C T 2: 26,439,025 V993I probably benign Het
Skint5 T A 4: 113,630,419 I901F unknown Het
Slc17a3 A T 13: 23,846,247 I114F probably benign Het
Slc17a7 T A 7: 45,168,864 L71Q probably damaging Het
Slc43a2 T C 11: 75,570,577 S452P probably damaging Het
Smarca4 A G 9: 21,635,698 N173S possibly damaging Het
Tbc1d21 T C 9: 58,362,912 Y161C probably damaging Het
Tpsab1 C A 17: 25,345,107 C94F probably damaging Het
Unc80 G T 1: 66,671,608 A2679S possibly damaging Het
Vdac1 T A 11: 52,384,077 V184E probably damaging Het
Vmn2r24 T A 6: 123,787,026 S287R probably benign Het
Vmn2r91 T C 17: 18,135,786 F572L probably benign Het
Vps13b G A 15: 35,884,555 E3125K probably benign Het
Ythdf3 A G 3: 16,204,895 N406S possibly damaging Het
Zfp708 T C 13: 67,071,187 K158E probably damaging Het
Other mutations in Ubr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ubr5 APN 15 37984036 missense probably damaging 1.00
IGL00548:Ubr5 APN 15 38004321 missense probably benign 0.11
IGL00675:Ubr5 APN 15 38018284 missense possibly damaging 0.84
IGL00770:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00774:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00919:Ubr5 APN 15 38040842 missense probably damaging 1.00
IGL00962:Ubr5 APN 15 37985934 missense probably damaging 1.00
IGL01328:Ubr5 APN 15 37981523 missense possibly damaging 0.82
IGL01359:Ubr5 APN 15 37973006 missense probably damaging 0.96
IGL01394:Ubr5 APN 15 38009631 missense possibly damaging 0.90
IGL01674:Ubr5 APN 15 37998379 missense probably damaging 1.00
IGL01981:Ubr5 APN 15 37996598 missense probably benign 0.08
IGL01993:Ubr5 APN 15 37973012 missense probably damaging 0.99
IGL02159:Ubr5 APN 15 37991379 splice site probably benign
IGL02252:Ubr5 APN 15 38024894 missense probably damaging 1.00
IGL02442:Ubr5 APN 15 38037901 missense possibly damaging 0.95
IGL02502:Ubr5 APN 15 38030689 missense probably benign 0.01
IGL02503:Ubr5 APN 15 38018320 missense possibly damaging 0.90
IGL02503:Ubr5 APN 15 38018314 missense probably damaging 0.99
IGL02546:Ubr5 APN 15 38008747 missense probably benign 0.00
IGL02556:Ubr5 APN 15 38002448 missense probably benign 0.18
IGL02647:Ubr5 APN 15 37992082 missense probably damaging 0.99
IGL02679:Ubr5 APN 15 38002314 missense probably benign 0.36
IGL02726:Ubr5 APN 15 38000562 splice site probably benign
IGL02884:Ubr5 APN 15 37998376 missense probably damaging 1.00
IGL02972:Ubr5 APN 15 38041952 missense probably damaging 1.00
IGL03000:Ubr5 APN 15 38024852 missense probably damaging 0.99
IGL03028:Ubr5 APN 15 38047593 missense probably benign 0.00
IGL03057:Ubr5 APN 15 38040906 splice site probably benign
IGL03085:Ubr5 APN 15 38029568 missense probably damaging 1.00
IGL03198:Ubr5 APN 15 38045720 missense probably damaging 1.00
IGL03368:Ubr5 APN 15 37998316 missense probably damaging 0.96
P0016:Ubr5 UTSW 15 38000578 missense probably damaging 1.00
PIT4142001:Ubr5 UTSW 15 38041909 missense probably damaging 0.98
R0133:Ubr5 UTSW 15 37996571 missense probably damaging 0.98
R0173:Ubr5 UTSW 15 38004675 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0314:Ubr5 UTSW 15 37997187 missense probably damaging 0.99
R0379:Ubr5 UTSW 15 38018957 missense probably benign 0.00
R0390:Ubr5 UTSW 15 38030672 missense probably benign 0.19
R0415:Ubr5 UTSW 15 37972980 missense probably damaging 0.98
R0531:Ubr5 UTSW 15 37991344 missense probably benign 0.34
R0650:Ubr5 UTSW 15 38030807 splice site probably benign
R0720:Ubr5 UTSW 15 37972991 missense probably damaging 0.98
R1183:Ubr5 UTSW 15 37997175 missense possibly damaging 0.71
R1302:Ubr5 UTSW 15 38041479 missense possibly damaging 0.91
R1442:Ubr5 UTSW 15 38014924 splice site probably benign
R1507:Ubr5 UTSW 15 37980870 missense probably damaging 1.00
R1575:Ubr5 UTSW 15 38040841 missense probably damaging 1.00
R1577:Ubr5 UTSW 15 38030730 missense possibly damaging 0.76
R1622:Ubr5 UTSW 15 38009113 unclassified probably benign
R1721:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1799:Ubr5 UTSW 15 37989377 missense probably damaging 1.00
R1840:Ubr5 UTSW 15 37980917 missense possibly damaging 0.51
R1867:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1868:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R2065:Ubr5 UTSW 15 38040842 missense probably damaging 1.00
R2107:Ubr5 UTSW 15 37989302 missense probably benign 0.00
R2201:Ubr5 UTSW 15 38002299 missense possibly damaging 0.83
R2261:Ubr5 UTSW 15 37988284 missense probably damaging 0.99
R2441:Ubr5 UTSW 15 37989345 missense probably damaging 0.99
R3008:Ubr5 UTSW 15 38030845 missense probably benign
R3412:Ubr5 UTSW 15 38004235 splice site probably benign
R3898:Ubr5 UTSW 15 37997739 missense probably benign 0.02
R3900:Ubr5 UTSW 15 38019242 missense probably damaging 1.00
R4032:Ubr5 UTSW 15 38024837 missense probably benign 0.22
R4352:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R4362:Ubr5 UTSW 15 38078403 missense probably damaging 0.99
R4467:Ubr5 UTSW 15 38004336 missense probably damaging 1.00
R4507:Ubr5 UTSW 15 38013542 missense probably damaging 0.96
R4683:Ubr5 UTSW 15 38037967 missense probably damaging 1.00
R4771:Ubr5 UTSW 15 38018297 missense possibly damaging 0.50
R4878:Ubr5 UTSW 15 38006564 missense probably benign 0.01
R4999:Ubr5 UTSW 15 38009668 missense probably benign 0.06
R5057:Ubr5 UTSW 15 38004109 missense probably damaging 0.98
R5177:Ubr5 UTSW 15 38006517 missense probably benign 0.22
R5186:Ubr5 UTSW 15 37997916 missense probably damaging 0.99
R5378:Ubr5 UTSW 15 37989578 missense probably damaging 1.00
R5486:Ubr5 UTSW 15 38008739 missense probably benign 0.00
R5494:Ubr5 UTSW 15 38019281 missense possibly damaging 0.78
R5617:Ubr5 UTSW 15 38030657 missense possibly damaging 0.47
R5636:Ubr5 UTSW 15 37983996 missense probably damaging 1.00
R5655:Ubr5 UTSW 15 38015093 missense probably damaging 0.99
R5715:Ubr5 UTSW 15 38002233 missense probably benign 0.06
R5781:Ubr5 UTSW 15 38006541 missense probably benign 0.27
R6645:Ubr5 UTSW 15 38029506 missense probably damaging 1.00
R6774:Ubr5 UTSW 15 38015135 missense probably damaging 1.00
R6823:Ubr5 UTSW 15 37989598 missense probably benign 0.08
R6877:Ubr5 UTSW 15 38002570 missense probably damaging 0.98
R7105:Ubr5 UTSW 15 38008775 missense
X0024:Ubr5 UTSW 15 37992060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTTCAACTGCTACTCCAAAGC -3'
(R):5'- GGCATTTCAAAACCTTTTGCAC -3'

Sequencing Primer
(F):5'- TGCTACTCCAAAGCACAGC -3'
(R):5'- ACCTTTTGCACACATTTGTAGTGTG -3'
Posted On2014-12-04