Incidental Mutation 'R0314:Cobll1'
ID25356
Institutional Source Beutler Lab
Gene Symbol Cobll1
Ensembl Gene ENSMUSG00000034903
Gene NameCobl-like 1
SynonymsD430044D16Rik, Coblr1
MMRRC Submission 038524-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R0314 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location65088339-65239403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65089521 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1187 (K1187E)
Ref Sequence ENSEMBL: ENSMUSP00000108049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090896] [ENSMUST00000102726] [ENSMUST00000112429] [ENSMUST00000112430] [ENSMUST00000112431]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090896
AA Change: K1188E

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088412
Gene: ENSMUSG00000034903
AA Change: K1188E

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 1.3e-38 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 426 438 N/A INTRINSIC
low complexity region 1023 1034 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102726
AA Change: K1225E

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099787
Gene: ENSMUSG00000034903
AA Change: K1225E

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 5.6e-39 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1060 1071 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112429
AA Change: K1226E

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108048
Gene: ENSMUSG00000034903
AA Change: K1226E

DomainStartEndE-ValueType
Pfam:Cobl 148 239 5.4e-49 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1061 1072 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112430
AA Change: K1187E

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108049
Gene: ENSMUSG00000034903
AA Change: K1187E

DomainStartEndE-ValueType
low complexity region 146 157 N/A INTRINSIC
Pfam:Cobl 185 263 1.3e-38 PFAM
low complexity region 331 342 N/A INTRINSIC
low complexity region 425 437 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112431
AA Change: K1226E

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108050
Gene: ENSMUSG00000034903
AA Change: K1226E

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
Pfam:Cobl 186 264 5.6e-39 PFAM
low complexity region 332 343 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
low complexity region 1061 1072 N/A INTRINSIC
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.9%
  • 20x: 88.7%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arih2 T C 9: 108,608,679 N345D probably damaging Het
Ascc3 C T 10: 50,637,999 S298L possibly damaging Het
Cacna1e A G 1: 154,442,251 Y1462H probably damaging Het
Car9 T C 4: 43,509,212 probably null Het
Cenpc1 A T 5: 86,037,371 M427K probably benign Het
Chl1 T A 6: 103,647,301 C57S probably damaging Het
Cntn3 T C 6: 102,420,381 Y77C probably damaging Het
Fkbpl C T 17: 34,646,052 H265Y possibly damaging Het
Fmo1 T G 1: 162,859,462 E32A probably damaging Het
Fnip2 G A 3: 79,481,189 T715I probably damaging Het
Fzd6 T A 15: 39,025,733 I82K possibly damaging Het
Gm12169 G A 11: 46,528,537 C60Y probably damaging Het
Grm5 T C 7: 87,602,955 S138P probably damaging Het
Klra5 T C 6: 129,903,590 Y115C probably damaging Het
Lgr4 T C 2: 109,991,093 probably benign Het
Limd1 T G 9: 123,516,827 I557S probably benign Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Neb A T 2: 52,243,331 D3398E probably benign Het
Nup155 T C 15: 8,147,252 S1005P probably benign Het
Olfr1396 A T 11: 49,113,692 D11E possibly damaging Het
Olfr69 T C 7: 103,768,181 D72G probably damaging Het
Pebp4 G T 14: 70,059,654 S214I possibly damaging Het
Pex26 T C 6: 121,184,484 probably null Het
Rbbp8 A T 18: 11,715,818 Q230L probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo2 G A 16: 73,956,637 T784M probably damaging Het
Slc5a1 T C 5: 33,146,651 I270T probably benign Het
Spag4 C T 2: 156,067,309 probably benign Het
Stt3a T C 9: 36,749,545 probably benign Het
Svep1 C T 4: 58,096,331 E1430K possibly damaging Het
Uba6 A T 5: 86,118,087 V956E probably damaging Het
Ube2j1 T A 4: 33,043,991 probably benign Het
Ubr5 A G 15: 37,997,187 S1741P probably damaging Het
Vmn2r1 A G 3: 64,086,559 T109A probably damaging Het
Vmn2r60 T C 7: 42,135,561 probably benign Het
Vstm2a A G 11: 16,368,388 probably benign Het
Zdhhc20 T A 14: 57,856,619 K195N probably damaging Het
Zfp683 A G 4: 134,058,741 Y393C probably benign Het
Zzz3 T C 3: 152,427,448 S48P probably benign Het
Other mutations in Cobll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Cobll1 APN 2 65126013 missense probably damaging 1.00
IGL01074:Cobll1 APN 2 65107848 missense probably damaging 1.00
IGL01093:Cobll1 APN 2 65098237 missense probably damaging 1.00
IGL02411:Cobll1 APN 2 65097740 missense probably damaging 1.00
IGL02419:Cobll1 APN 2 65151048 missense probably damaging 1.00
IGL02550:Cobll1 APN 2 65107863 missense probably damaging 1.00
IGL02607:Cobll1 APN 2 65151085 missense probably damaging 0.98
IGL02829:Cobll1 APN 2 65126045 missense probably damaging 1.00
IGL02802:Cobll1 UTSW 2 65098319 missense probably damaging 0.99
R0313:Cobll1 UTSW 2 65095744 nonsense probably null
R0322:Cobll1 UTSW 2 65102098 missense possibly damaging 0.84
R0846:Cobll1 UTSW 2 65102065 splice site probably null
R1163:Cobll1 UTSW 2 65098279 missense probably damaging 0.96
R1242:Cobll1 UTSW 2 65151169 critical splice acceptor site probably null
R1364:Cobll1 UTSW 2 65126310 splice site probably benign
R1445:Cobll1 UTSW 2 65099136 missense probably damaging 1.00
R1610:Cobll1 UTSW 2 65133642 missense probably damaging 1.00
R1836:Cobll1 UTSW 2 65126236 missense probably damaging 1.00
R2102:Cobll1 UTSW 2 65098210 missense probably damaging 1.00
R3154:Cobll1 UTSW 2 65107050 missense probably benign 0.00
R4580:Cobll1 UTSW 2 65151073 missense probably benign 0.00
R4638:Cobll1 UTSW 2 65099237 missense probably benign 0.03
R4684:Cobll1 UTSW 2 65099028 missense possibly damaging 0.90
R4906:Cobll1 UTSW 2 65097693 missense probably benign 0.01
R4923:Cobll1 UTSW 2 65099258 missense possibly damaging 0.87
R5100:Cobll1 UTSW 2 65125901 missense probably benign 0.26
R5269:Cobll1 UTSW 2 65133771 nonsense probably null
R5419:Cobll1 UTSW 2 65103357 missense possibly damaging 0.57
R5637:Cobll1 UTSW 2 65125903 missense possibly damaging 0.90
R5745:Cobll1 UTSW 2 65098457 missense probably damaging 0.99
R5777:Cobll1 UTSW 2 65103268 missense probably benign 0.27
R6303:Cobll1 UTSW 2 65098033 missense possibly damaging 0.68
R6471:Cobll1 UTSW 2 65107884 missense probably damaging 1.00
X0020:Cobll1 UTSW 2 65103322 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCTAACGCTGAGGCAGTAAATG -3'
(R):5'- ACTGAACAGCTTGCCTGCACTC -3'

Sequencing Primer
(F):5'- CGCTGAGGCAGTAAATGTTAGTC -3'
(R):5'- GTTTGTTGTGGAAATAACAACTCTC -3'
Posted On2013-04-16