Incidental Mutation 'R2870:Kif1c'
ID253620
Institutional Source Beutler Lab
Gene Symbol Kif1c
Ensembl Gene ENSMUSG00000020821
Gene Namekinesin family member 1C
SynonymsB430105J22Rik, D11Bwg1349e, Orch3, N-3 kinsin
MMRRC Submission 040458-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2870 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70700548-70731964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70724081 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 567 (E567G)
Ref Sequence ENSEMBL: ENSMUSP00000123242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072187] [ENSMUST00000094499] [ENSMUST00000102554] [ENSMUST00000137119]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072187
AA Change: E567G

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072048
Gene: ENSMUSG00000020821
AA Change: E567G

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 673 N/A INTRINSIC
coiled coil region 842 883 N/A INTRINSIC
low complexity region 955 975 N/A INTRINSIC
low complexity region 1009 1055 N/A INTRINSIC
low complexity region 1072 1100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094499
AA Change: E567G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092075
Gene: ENSMUSG00000020821
AA Change: E567G

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 671 N/A INTRINSIC
coiled coil region 830 871 N/A INTRINSIC
low complexity region 943 963 N/A INTRINSIC
low complexity region 997 1043 N/A INTRINSIC
low complexity region 1060 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102554
AA Change: E567G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099614
Gene: ENSMUSG00000020821
AA Change: E567G

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 671 N/A INTRINSIC
coiled coil region 830 871 N/A INTRINSIC
low complexity region 943 963 N/A INTRINSIC
low complexity region 997 1043 N/A INTRINSIC
low complexity region 1060 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137119
AA Change: E567G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123242
Gene: ENSMUSG00000020821
AA Change: E567G

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 671 N/A INTRINSIC
coiled coil region 830 871 N/A INTRINSIC
low complexity region 943 963 N/A INTRINSIC
low complexity region 997 1043 N/A INTRINSIC
low complexity region 1060 1088 N/A INTRINSIC
Meta Mutation Damage Score 0.364 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.5%
  • 10x: 94.1%
  • 20x: 79.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin-like protein family. The family members are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. Mutations in this gene are a cause of spastic ataxia 2, autosomal recessive. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a reporter allele are viable, fertile and overtly normal and display normal motor-dependent retrograde Golgi apparatus-to-endoplasmic reticulum transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A T 10: 22,067,379 I234N probably benign Het
Actrt3 A G 3: 30,599,698 V51A probably damaging Het
Adgb C T 10: 10,431,281 probably null Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd10 C T 8: 11,615,682 R306H probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Cacna2d1 G A 5: 16,312,568 C404Y probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Csmd3 C T 15: 47,857,924 G1437D probably damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Dcp1b C T 6: 119,214,774 S217L probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Dmp1 A G 5: 104,212,108 S217G probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eral1 A G 11: 78,076,278 I164T possibly damaging Het
Esr1 G A 10: 4,997,890 R481H probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gria4 T A 9: 4,503,614 N334I probably damaging Het
Grm5 T C 7: 87,602,722 V60A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ino80d C T 1: 63,061,039 probably null Het
Krt31 T G 11: 100,047,873 N298T possibly damaging Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mdm1 A G 10: 118,150,942 T267A probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mmp1b A T 9: 7,386,875 silent Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Mylk2 A G 2: 152,919,348 K457R probably damaging Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1080 T C 2: 86,553,584 D180G possibly damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Pcdhb20 A T 18: 37,505,780 Q453L possibly damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Retnla A G 16: 48,843,612 R90G probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Spcs2 T C 7: 99,839,761 D240G probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Thbs1 C G 2: 118,119,378 N611K probably damaging Het
Tipin A C 9: 64,304,327 S232R probably benign Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Kif1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Kif1c APN 11 70724134 splice site probably null
IGL00817:Kif1c APN 11 70705253 missense probably benign 0.25
IGL00849:Kif1c APN 11 70706127 missense probably damaging 1.00
IGL01988:Kif1c APN 11 70704936 missense probably damaging 1.00
IGL02683:Kif1c APN 11 70726452 missense possibly damaging 0.85
IGL03024:Kif1c APN 11 70705189 missense probably damaging 1.00
R0570:Kif1c UTSW 11 70704465 missense probably damaging 0.96
R0647:Kif1c UTSW 11 70726141 missense probably damaging 1.00
R0710:Kif1c UTSW 11 70726497 missense probably benign
R1112:Kif1c UTSW 11 70724815 splice site probably null
R1199:Kif1c UTSW 11 70708601 missense possibly damaging 0.69
R1514:Kif1c UTSW 11 70705729 missense probably damaging 1.00
R1660:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1661:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1666:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1669:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1707:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1708:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1835:Kif1c UTSW 11 70708971 missense probably damaging 0.99
R1861:Kif1c UTSW 11 70703342 missense probably damaging 1.00
R2870:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2871:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2871:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2872:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2872:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2927:Kif1c UTSW 11 70726314 missense probably benign
R3720:Kif1c UTSW 11 70703771 missense possibly damaging 0.94
R4809:Kif1c UTSW 11 70726357 missense probably benign 0.10
R4914:Kif1c UTSW 11 70708855 missense probably damaging 0.99
R5642:Kif1c UTSW 11 70708447 missense probably benign 0.14
R5788:Kif1c UTSW 11 70708828 missense probably damaging 1.00
R5861:Kif1c UTSW 11 70703795 missense probably damaging 1.00
R6918:Kif1c UTSW 11 70706987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGGGAGTCACAGTAGGG -3'
(R):5'- GACCTGTACTCTGTAACACAGC -3'

Sequencing Primer
(F):5'- GAGTCACAGTAGGGTCTCTAAC -3'
(R):5'- TGTACTCTGTAACACAGCTTTTG -3'
Posted On2014-12-04