Incidental Mutation 'R2513:Kcnu1'
ID253627
Institutional Source Beutler Lab
Gene Symbol Kcnu1
Ensembl Gene ENSMUSG00000031576
Gene Namepotassium channel, subfamily U, member 1
SynonymsKcnma3, Slo3
MMRRC Submission 040419-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2513 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location25849623-25937939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25905966 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 660 (C660S)
Ref Sequence ENSEMBL: ENSMUSP00000096457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098858]
Predicted Effect probably benign
Transcript: ENSMUST00000098858
AA Change: C660S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000096457
Gene: ENSMUSG00000031576
AA Change: C660S

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Pfam:Ion_trans 101 323 6.9e-21 PFAM
Pfam:Ion_trans_2 229 317 4.7e-12 PFAM
low complexity region 367 380 N/A INTRINSIC
Pfam:BK_channel_a 462 557 1.2e-28 PFAM
low complexity region 670 689 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium channel family of proteins. The encoded voltage-gated ion channel allows the outward flow of potassium ions during plasma membrane hyperpolarization in sperm. Opening of this channel may be regulated by calcium ion levels. Homozygous knockout mice that lack the related mouse gene exhibit male sterility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous male mutants are infertile with impaired sperm capacitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,661,852 T719A possibly damaging Het
9530053A07Rik C G 7: 28,131,635 S91C probably damaging Het
Abcc1 A G 16: 14,473,009 probably null Het
Aftph C T 11: 20,708,676 probably null Het
Als2 C A 1: 59,215,117 K360N probably benign Het
Atg2a T A 19: 6,258,046 probably null Het
Axl T C 7: 25,787,516 D22G probably benign Het
Baiap2 G A 11: 119,999,226 A438T probably benign Het
Bean1 G C 8: 104,182,011 A7P probably benign Het
Birc6 C G 17: 74,647,729 P3431R probably damaging Het
Camk1d A G 2: 5,714,236 M1T probably null Het
Carmil3 T C 14: 55,503,838 Y1027H probably damaging Het
Ccdc6 G A 10: 70,187,828 probably benign Het
Cemip C A 7: 83,942,025 V1280L probably benign Het
Cfap58 C A 19: 47,962,542 N447K probably benign Het
Chd3 A G 11: 69,360,645 L520P probably damaging Het
Col1a2 T A 6: 4,531,223 probably null Het
Cpne7 A C 8: 123,117,667 probably null Het
Ctla4 T C 1: 60,912,564 V84A probably damaging Het
Dap3 A G 3: 88,928,258 V263A probably benign Het
Dhx57 T A 17: 80,241,949 probably null Het
Dlg5 C A 14: 24,164,525 K663N probably damaging Het
Dsg3 C A 18: 20,523,662 F196L possibly damaging Het
Eif2ak4 C A 2: 118,426,583 D402E probably damaging Het
Fam208b G T 13: 3,582,150 L784I possibly damaging Het
Fance T C 17: 28,318,094 V24A probably benign Het
Fasn A T 11: 120,814,748 L1149Q probably damaging Het
Flg T A 3: 93,279,786 S182T possibly damaging Het
Gm128 T A 3: 95,239,982 S334C possibly damaging Het
Gm3727 A C 14: 7,264,561 H31Q probably damaging Het
Gm4841 T G 18: 60,270,905 T39P probably damaging Het
Golgb1 G T 16: 36,915,151 V1587L possibly damaging Het
Golm1 G A 13: 59,642,258 P243S probably benign Het
Gstcd C A 3: 133,082,320 A206S possibly damaging Het
Gstcd C A 3: 133,082,321 K205N possibly damaging Het
Gtf3c1 A G 7: 125,681,173 V355A probably benign Het
Hhatl T C 9: 121,789,170 D173G probably benign Het
Kctd8 T C 5: 69,110,645 D374G probably benign Het
Kif21a T C 15: 90,994,391 I229V possibly damaging Het
L3mbtl1 A T 2: 162,967,585 I702F probably benign Het
Lce1d T C 3: 92,685,759 probably benign Het
Lrig1 C T 6: 94,617,366 probably null Het
Lrp12 A T 15: 39,876,111 D563E probably damaging Het
Lrp2 C T 2: 69,506,374 probably null Het
Map3k5 G A 10: 20,094,455 V703I possibly damaging Het
Mecr A G 4: 131,853,765 R110G probably benign Het
Mtrr T A 13: 68,566,973 K445* probably null Het
Nanos1 T A 19: 60,756,552 L96Q probably benign Het
Olfr538 T G 7: 140,574,156 M1R probably null Het
Olfr574 T A 7: 102,949,493 F333I probably benign Het
Olfr807 T A 10: 129,755,152 L99F probably damaging Het
Otog T C 7: 46,305,590 probably null Het
Pcdhb3 T A 18: 37,301,239 L86* probably null Het
Pcdhb3 A T 18: 37,301,240 L86F probably damaging Het
Pcdhb3 G T 18: 37,301,241 V87F probably benign Het
Pdgfd A G 9: 6,359,894 K322E probably damaging Het
Picalm T C 7: 90,197,009 S648P probably damaging Het
Pigr T C 1: 130,846,620 S446P possibly damaging Het
Pik3cb A C 9: 99,061,842 L636W probably damaging Het
Pla2g2f A T 4: 138,754,162 L92Q probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prkar2b C T 12: 31,975,929 V191I possibly damaging Het
Prune1 C A 3: 95,258,119 A281S probably benign Het
Ptges3l A T 11: 101,424,042 C42S possibly damaging Het
Reg3b A T 6: 78,371,819 I33L probably benign Het
Rel A G 11: 23,745,823 I188T probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor1 G T 8: 105,617,622 V463L probably benign Het
Rrm1 T A 7: 102,460,689 D510E probably damaging Het
Setd7 A G 3: 51,533,015 S202P probably damaging Het
Shank3 T A 15: 89,548,686 D1211E probably benign Het
Slc30a1 A T 1: 191,907,562 T186S possibly damaging Het
Slc4a4 G A 5: 89,156,398 V523I probably benign Het
Slc9a2 T A 1: 40,742,608 probably null Het
Smg6 A G 11: 74,929,676 T258A probably damaging Het
Sptlc1 C T 13: 53,337,640 D408N possibly damaging Het
Tbl3 T C 17: 24,704,550 probably null Het
Tdo2 T C 3: 81,969,505 D139G possibly damaging Het
Ticam1 T A 17: 56,271,612 H161L possibly damaging Het
Tnfaip3 T A 10: 19,005,659 D293V probably benign Het
Trim72 G A 7: 128,004,706 V75M possibly damaging Het
Trip11 T A 12: 101,837,727 N1632I possibly damaging Het
Tspan18 A T 2: 93,220,095 M61K possibly damaging Het
Tuba8 A T 6: 121,225,973 E415V probably damaging Het
Ung A G 5: 114,137,192 H214R probably benign Het
Uqcrc1 T C 9: 108,936,768 L17P probably damaging Het
Usp24 A G 4: 106,379,405 probably null Het
Vps39 A C 2: 120,338,787 Y245D probably damaging Het
Whrn T A 4: 63,435,412 T373S probably benign Het
Zc2hc1a C T 3: 7,516,536 probably null Het
Other mutations in Kcnu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Kcnu1 APN 8 25897856 missense probably benign 0.00
IGL00580:Kcnu1 APN 8 25865663 missense probably benign 0.04
IGL00675:Kcnu1 APN 8 25851849 missense probably benign
IGL00928:Kcnu1 APN 8 25849735 missense probably damaging 1.00
IGL01324:Kcnu1 APN 8 25849707 missense probably benign 0.22
IGL01346:Kcnu1 APN 8 25934523 splice site probably benign
IGL01361:Kcnu1 APN 8 25886768 missense possibly damaging 0.78
IGL01651:Kcnu1 APN 8 25861095 missense probably damaging 1.00
IGL01795:Kcnu1 APN 8 25913705 missense probably damaging 1.00
IGL01800:Kcnu1 APN 8 25937500 missense probably damaging 1.00
IGL01975:Kcnu1 APN 8 25934497 missense probably benign 0.29
IGL02103:Kcnu1 APN 8 25905948 missense possibly damaging 0.83
IGL02109:Kcnu1 APN 8 25937699 missense possibly damaging 0.66
IGL02127:Kcnu1 APN 8 25892062 missense probably damaging 1.00
IGL02170:Kcnu1 APN 8 25937560 missense probably damaging 1.00
IGL02217:Kcnu1 APN 8 25858184 missense probably damaging 1.00
IGL02385:Kcnu1 APN 8 25932270 missense probably damaging 1.00
IGL02493:Kcnu1 APN 8 25937520 missense possibly damaging 0.68
IGL02883:Kcnu1 APN 8 25849827 missense probably benign
IGL02884:Kcnu1 APN 8 25921528 missense probably damaging 1.00
IGL03022:Kcnu1 APN 8 25937586 missense probably damaging 0.98
IGL03281:Kcnu1 APN 8 25892077 missense probably null 1.00
IGL03345:Kcnu1 APN 8 25881293 splice site probably benign
P0026:Kcnu1 UTSW 8 25892122 missense probably damaging 1.00
PIT4677001:Kcnu1 UTSW 8 25905993 missense probably benign
R0001:Kcnu1 UTSW 8 25859270 missense probably damaging 1.00
R0419:Kcnu1 UTSW 8 25937618 missense probably benign 0.13
R0518:Kcnu1 UTSW 8 25910888 missense probably damaging 1.00
R0521:Kcnu1 UTSW 8 25910888 missense probably damaging 1.00
R0581:Kcnu1 UTSW 8 25937501 missense probably damaging 1.00
R0840:Kcnu1 UTSW 8 25913684 start codon destroyed probably null 1.00
R1282:Kcnu1 UTSW 8 25905957 missense probably benign 0.02
R1556:Kcnu1 UTSW 8 25861191 critical splice donor site probably null
R1600:Kcnu1 UTSW 8 25849793 missense probably damaging 1.00
R2011:Kcnu1 UTSW 8 25918442 missense probably benign 0.03
R2035:Kcnu1 UTSW 8 25896693 missense probably benign 0.35
R2082:Kcnu1 UTSW 8 25921549 missense probably damaging 1.00
R2132:Kcnu1 UTSW 8 25851900 missense probably damaging 0.99
R2415:Kcnu1 UTSW 8 25910878 missense probably benign
R3712:Kcnu1 UTSW 8 25881420 missense probably damaging 1.00
R3749:Kcnu1 UTSW 8 25886770 missense probably null 0.01
R3840:Kcnu1 UTSW 8 25885352 missense possibly damaging 0.95
R3874:Kcnu1 UTSW 8 25885317 missense probably damaging 1.00
R4184:Kcnu1 UTSW 8 25862417 missense probably damaging 1.00
R4576:Kcnu1 UTSW 8 25890020 missense probably benign 0.06
R4658:Kcnu1 UTSW 8 25937555 missense probably damaging 1.00
R4667:Kcnu1 UTSW 8 25910921 missense possibly damaging 0.69
R4791:Kcnu1 UTSW 8 25913752 missense probably damaging 1.00
R4940:Kcnu1 UTSW 8 25897862 splice site probably null
R5120:Kcnu1 UTSW 8 25934488 missense possibly damaging 0.79
R5314:Kcnu1 UTSW 8 25862458 missense probably damaging 0.97
R5712:Kcnu1 UTSW 8 25919650 missense probably damaging 1.00
R5807:Kcnu1 UTSW 8 25849714 missense possibly damaging 0.78
R6237:Kcnu1 UTSW 8 25932334 missense probably benign
R6260:Kcnu1 UTSW 8 25851891 missense probably damaging 1.00
R6360:Kcnu1 UTSW 8 25861180 missense possibly damaging 0.73
R6612:Kcnu1 UTSW 8 25918316 missense probably benign 0.10
R6708:Kcnu1 UTSW 8 25937711 missense probably benign
R6765:Kcnu1 UTSW 8 25913645 missense probably damaging 1.00
R6816:Kcnu1 UTSW 8 25937734 nonsense probably null
R7030:Kcnu1 UTSW 8 25918463 missense probably benign 0.00
R7202:Kcnu1 UTSW 8 25919581 splice site probably null
R7208:Kcnu1 UTSW 8 25919637 nonsense probably null
R7411:Kcnu1 UTSW 8 25892088 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGACTAGCTAGGGGTTCC -3'
(R):5'- CTATATGACACAGGGCTGAAGC -3'

Sequencing Primer
(F):5'- CCAGTGTCTTCCTAGTCAGAGGAG -3'
(R):5'- GCTGAAGCAGAGATGAATTTACTTTG -3'
Posted On2014-12-04