Incidental Mutation 'R2513:Map3k5'
ID253645
Institutional Source Beutler Lab
Gene Symbol Map3k5
Ensembl Gene ENSMUSG00000071369
Gene Namemitogen-activated protein kinase kinase kinase 5
SynonymsASK, ASK1, 7420452D20Rik, Mekk5
MMRRC Submission 040419-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2513 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location19934472-20142753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20094455 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 703 (V703I)
Ref Sequence ENSEMBL: ENSMUSP00000112864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095806] [ENSMUST00000120259] [ENSMUST00000129437]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095806
AA Change: V711I

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093485
Gene: ENSMUSG00000071369
AA Change: V711I

DomainStartEndE-ValueType
low complexity region 26 43 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
Pfam:DUF4071 172 552 2.1e-162 PFAM
S_TKc 687 945 8.08e-92 SMART
low complexity region 1195 1207 N/A INTRINSIC
low complexity region 1225 1238 N/A INTRINSIC
coiled coil region 1251 1292 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120259
AA Change: V703I

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112864
Gene: ENSMUSG00000071369
AA Change: V703I

DomainStartEndE-ValueType
low complexity region 26 43 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
Pfam:DUF4071 172 544 1.7e-156 PFAM
S_TKc 679 937 8.08e-92 SMART
low complexity region 1187 1199 N/A INTRINSIC
low complexity region 1217 1230 N/A INTRINSIC
coiled coil region 1243 1284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129437
AA Change: V56I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000114518
Gene: ENSMUSG00000071369
AA Change: V56I

DomainStartEndE-ValueType
Pfam:Pkinase 34 144 7.6e-20 PFAM
Pfam:Pkinase_Tyr 34 144 5e-14 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitogen-activated protein kinase (MAPK) signaling cascades include MAPK or extracellular signal-regulated kinase (ERK), MAPK kinase (MKK or MEK), and MAPK kinase kinase (MAPKKK or MEKK). MAPKK kinase/MEKK phosphorylates and activates its downstream protein kinase, MAPK kinase/MEK, which in turn activates MAPK. The kinases of these signaling cascades are highly conserved, and homologs exist in yeast, Drosophila, and mammalian cells. MAPKKK5 contains 1,374 amino acids with all 11 kinase subdomains. Northern blot analysis shows that MAPKKK5 transcript is abundantly expressed in human heart and pancreas. The MAPKKK5 protein phosphorylates and activates MKK4 (aliases SERK1, MAPKK4) in vitro, and activates c-Jun N-terminal kinase (JNK)/stress-activated protein kinase (SAPK) during transient expression in COS and 293 cells; MAPKKK5 does not activate MAPK/ERK. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are overtly normal, however apoptosis abnormalities are evident in cultured cells and after induced heart damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,661,852 T719A possibly damaging Het
9530053A07Rik C G 7: 28,131,635 S91C probably damaging Het
Abcc1 A G 16: 14,473,009 probably null Het
Aftph C T 11: 20,708,676 probably null Het
Als2 C A 1: 59,215,117 K360N probably benign Het
Atg2a T A 19: 6,258,046 probably null Het
Axl T C 7: 25,787,516 D22G probably benign Het
Baiap2 G A 11: 119,999,226 A438T probably benign Het
Bean1 G C 8: 104,182,011 A7P probably benign Het
Birc6 C G 17: 74,647,729 P3431R probably damaging Het
Camk1d A G 2: 5,714,236 M1T probably null Het
Carmil3 T C 14: 55,503,838 Y1027H probably damaging Het
Ccdc6 G A 10: 70,187,828 probably benign Het
Cemip C A 7: 83,942,025 V1280L probably benign Het
Cfap58 C A 19: 47,962,542 N447K probably benign Het
Chd3 A G 11: 69,360,645 L520P probably damaging Het
Col1a2 T A 6: 4,531,223 probably null Het
Cpne7 A C 8: 123,117,667 probably null Het
Ctla4 T C 1: 60,912,564 V84A probably damaging Het
Dap3 A G 3: 88,928,258 V263A probably benign Het
Dhx57 T A 17: 80,241,949 probably null Het
Dlg5 C A 14: 24,164,525 K663N probably damaging Het
Dsg3 C A 18: 20,523,662 F196L possibly damaging Het
Eif2ak4 C A 2: 118,426,583 D402E probably damaging Het
Fam208b G T 13: 3,582,150 L784I possibly damaging Het
Fance T C 17: 28,318,094 V24A probably benign Het
Fasn A T 11: 120,814,748 L1149Q probably damaging Het
Flg T A 3: 93,279,786 S182T possibly damaging Het
Gm128 T A 3: 95,239,982 S334C possibly damaging Het
Gm3727 A C 14: 7,264,561 H31Q probably damaging Het
Gm4841 T G 18: 60,270,905 T39P probably damaging Het
Golgb1 G T 16: 36,915,151 V1587L possibly damaging Het
Golm1 G A 13: 59,642,258 P243S probably benign Het
Gstcd C A 3: 133,082,320 A206S possibly damaging Het
Gstcd C A 3: 133,082,321 K205N possibly damaging Het
Gtf3c1 A G 7: 125,681,173 V355A probably benign Het
Hhatl T C 9: 121,789,170 D173G probably benign Het
Kcnu1 T A 8: 25,905,966 C660S probably benign Het
Kctd8 T C 5: 69,110,645 D374G probably benign Het
Kif21a T C 15: 90,994,391 I229V possibly damaging Het
L3mbtl1 A T 2: 162,967,585 I702F probably benign Het
Lce1d T C 3: 92,685,759 probably benign Het
Lrig1 C T 6: 94,617,366 probably null Het
Lrp12 A T 15: 39,876,111 D563E probably damaging Het
Lrp2 C T 2: 69,506,374 probably null Het
Mecr A G 4: 131,853,765 R110G probably benign Het
Mtrr T A 13: 68,566,973 K445* probably null Het
Nanos1 T A 19: 60,756,552 L96Q probably benign Het
Olfr538 T G 7: 140,574,156 M1R probably null Het
Olfr574 T A 7: 102,949,493 F333I probably benign Het
Olfr807 T A 10: 129,755,152 L99F probably damaging Het
Otog T C 7: 46,305,590 probably null Het
Pcdhb3 T A 18: 37,301,239 L86* probably null Het
Pcdhb3 A T 18: 37,301,240 L86F probably damaging Het
Pcdhb3 G T 18: 37,301,241 V87F probably benign Het
Pdgfd A G 9: 6,359,894 K322E probably damaging Het
Picalm T C 7: 90,197,009 S648P probably damaging Het
Pigr T C 1: 130,846,620 S446P possibly damaging Het
Pik3cb A C 9: 99,061,842 L636W probably damaging Het
Pla2g2f A T 4: 138,754,162 L92Q probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prkar2b C T 12: 31,975,929 V191I possibly damaging Het
Prune1 C A 3: 95,258,119 A281S probably benign Het
Ptges3l A T 11: 101,424,042 C42S possibly damaging Het
Reg3b A T 6: 78,371,819 I33L probably benign Het
Rel A G 11: 23,745,823 I188T probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor1 G T 8: 105,617,622 V463L probably benign Het
Rrm1 T A 7: 102,460,689 D510E probably damaging Het
Setd7 A G 3: 51,533,015 S202P probably damaging Het
Shank3 T A 15: 89,548,686 D1211E probably benign Het
Slc30a1 A T 1: 191,907,562 T186S possibly damaging Het
Slc4a4 G A 5: 89,156,398 V523I probably benign Het
Slc9a2 T A 1: 40,742,608 probably null Het
Smg6 A G 11: 74,929,676 T258A probably damaging Het
Sptlc1 C T 13: 53,337,640 D408N possibly damaging Het
Tbl3 T C 17: 24,704,550 probably null Het
Tdo2 T C 3: 81,969,505 D139G possibly damaging Het
Ticam1 T A 17: 56,271,612 H161L possibly damaging Het
Tnfaip3 T A 10: 19,005,659 D293V probably benign Het
Trim72 G A 7: 128,004,706 V75M possibly damaging Het
Trip11 T A 12: 101,837,727 N1632I possibly damaging Het
Tspan18 A T 2: 93,220,095 M61K possibly damaging Het
Tuba8 A T 6: 121,225,973 E415V probably damaging Het
Ung A G 5: 114,137,192 H214R probably benign Het
Uqcrc1 T C 9: 108,936,768 L17P probably damaging Het
Usp24 A G 4: 106,379,405 probably null Het
Vps39 A C 2: 120,338,787 Y245D probably damaging Het
Whrn T A 4: 63,435,412 T373S probably benign Het
Zc2hc1a C T 3: 7,516,536 probably null Het
Other mutations in Map3k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Map3k5 APN 10 19935044 missense possibly damaging 0.73
IGL00978:Map3k5 APN 10 20141567 missense probably damaging 1.00
IGL01470:Map3k5 APN 10 20118187 missense possibly damaging 0.89
IGL01992:Map3k5 APN 10 20029133 nonsense probably null
IGL02479:Map3k5 APN 10 20056484 missense probably damaging 1.00
IGL02728:Map3k5 APN 10 20118292 missense possibly damaging 0.71
IGL02812:Map3k5 APN 10 20025036 missense probably damaging 1.00
IGL03104:Map3k5 APN 10 20132055 missense probably benign
P0033:Map3k5 UTSW 10 20132213 splice site probably benign
PIT4434001:Map3k5 UTSW 10 20026257 missense probably damaging 0.98
R0284:Map3k5 UTSW 10 20000613 missense probably damaging 0.99
R1103:Map3k5 UTSW 10 20023676 missense probably benign 0.00
R1172:Map3k5 UTSW 10 20056648 intron probably benign
R1250:Map3k5 UTSW 10 20110775 missense possibly damaging 0.73
R1493:Map3k5 UTSW 10 20029113 missense probably damaging 1.00
R1634:Map3k5 UTSW 10 20136911 missense possibly damaging 0.64
R1693:Map3k5 UTSW 10 20104242 missense probably damaging 1.00
R1713:Map3k5 UTSW 10 20110847 missense possibly damaging 0.79
R1832:Map3k5 UTSW 10 20099560 missense probably damaging 1.00
R1844:Map3k5 UTSW 10 20104163 missense probably benign 0.33
R1869:Map3k5 UTSW 10 20132109 nonsense probably null
R2156:Map3k5 UTSW 10 20024937 missense probably damaging 1.00
R2214:Map3k5 UTSW 10 20026289 critical splice donor site probably null
R2221:Map3k5 UTSW 10 20067920 missense possibly damaging 0.96
R2223:Map3k5 UTSW 10 20067920 missense possibly damaging 0.96
R2249:Map3k5 UTSW 10 20127697 missense probably damaging 0.99
R2418:Map3k5 UTSW 10 20110857 missense probably benign 0.02
R3014:Map3k5 UTSW 10 20094429 missense probably damaging 1.00
R3770:Map3k5 UTSW 10 20025019 missense probably damaging 0.99
R3814:Map3k5 UTSW 10 20026190 missense probably damaging 0.99
R3814:Map3k5 UTSW 10 20140680 missense probably damaging 0.99
R4706:Map3k5 UTSW 10 20058938 missense probably damaging 1.00
R4749:Map3k5 UTSW 10 20132052 missense probably benign 0.42
R4903:Map3k5 UTSW 10 20118489 missense probably null 1.00
R4958:Map3k5 UTSW 10 20023789 missense possibly damaging 0.79
R5065:Map3k5 UTSW 10 20082467 missense probably damaging 1.00
R5210:Map3k5 UTSW 10 20024901 missense possibly damaging 0.82
R5245:Map3k5 UTSW 10 20140691 missense probably benign 0.00
R5304:Map3k5 UTSW 10 20108238 missense probably benign 0.13
R5428:Map3k5 UTSW 10 20023653 missense possibly damaging 0.93
R5566:Map3k5 UTSW 10 20110719 missense probably damaging 1.00
R5914:Map3k5 UTSW 10 20104255 missense probably benign 0.24
R6155:Map3k5 UTSW 10 20118441 missense probably benign 0.01
R6161:Map3k5 UTSW 10 20000575 missense probably damaging 0.98
R6191:Map3k5 UTSW 10 20023669 missense probably damaging 0.99
R6251:Map3k5 UTSW 10 20138260 splice site probably null
R6800:Map3k5 UTSW 10 20141580 makesense probably null
R7304:Map3k5 UTSW 10 20099555 missense probably damaging 1.00
X0017:Map3k5 UTSW 10 20118434 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAAAAGGCCTAGTATTTGCTTGG -3'
(R):5'- CTTGAGTTGGAATTAACACGACAG -3'

Sequencing Primer
(F):5'- GGTCAACTTGGGCTATATGACCC -3'
(R):5'- CGACAGAGTTTCCAGACAGTTC -3'
Posted On2014-12-04